ID: 1034936660

View in Genome Browser
Species Human (GRCh38)
Location 7:155204464-155204486
Sequence GTGGAGAGGCGGCGTGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034936660_1034936670 21 Left 1034936660 7:155204464-155204486 CCATGTGCACGCCGCCTCTCCAC No data
Right 1034936670 7:155204508-155204530 CACCATGTGGCTCTGTGTCCTGG No data
1034936660_1034936672 30 Left 1034936660 7:155204464-155204486 CCATGTGCACGCCGCCTCTCCAC No data
Right 1034936672 7:155204517-155204539 GCTCTGTGTCCTGGCTCCACAGG No data
1034936660_1034936666 8 Left 1034936660 7:155204464-155204486 CCATGTGCACGCCGCCTCTCCAC No data
Right 1034936666 7:155204495-155204517 GCAGCCACCCTCGCACCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034936660 Original CRISPR GTGGAGAGGCGGCGTGCACA TGG (reversed) Intergenic
No off target data available for this crispr