ID: 1034937977

View in Genome Browser
Species Human (GRCh38)
Location 7:155211958-155211980
Sequence GCCAGGGCAGTGAGGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034937972_1034937977 -4 Left 1034937972 7:155211939-155211961 CCATGCAGGGCTGGGACAGGCCA No data
Right 1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG No data
1034937962_1034937977 28 Left 1034937962 7:155211907-155211929 CCACATGTTCCTGCAGGGCAGGG No data
Right 1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG No data
1034937964_1034937977 19 Left 1034937964 7:155211916-155211938 CCTGCAGGGCAGGGCAGCCTCCA No data
Right 1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG No data
1034937970_1034937977 -1 Left 1034937970 7:155211936-155211958 CCACCATGCAGGGCTGGGACAGG No data
Right 1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG No data
1034937969_1034937977 2 Left 1034937969 7:155211933-155211955 CCTCCACCATGCAGGGCTGGGAC No data
Right 1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034937977 Original CRISPR GCCAGGGCAGTGAGGGCTCA TGG Intergenic
No off target data available for this crispr