ID: 1034942938

View in Genome Browser
Species Human (GRCh38)
Location 7:155243701-155243723
Sequence CCTCTAGTACTGCTGGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034942938_1034942946 27 Left 1034942938 7:155243701-155243723 CCCTAACCCAGCAGTACTAGAGG No data
Right 1034942946 7:155243751-155243773 GAGGTGTGAGTTGGGAAATCAGG No data
1034942938_1034942948 29 Left 1034942938 7:155243701-155243723 CCCTAACCCAGCAGTACTAGAGG No data
Right 1034942948 7:155243753-155243775 GGTGTGAGTTGGGAAATCAGGGG No data
1034942938_1034942943 8 Left 1034942938 7:155243701-155243723 CCCTAACCCAGCAGTACTAGAGG No data
Right 1034942943 7:155243732-155243754 ACACACACACAGAAATATAGAGG 0: 318
1: 223
2: 154
3: 536
4: 3149
1034942938_1034942947 28 Left 1034942938 7:155243701-155243723 CCCTAACCCAGCAGTACTAGAGG No data
Right 1034942947 7:155243752-155243774 AGGTGTGAGTTGGGAAATCAGGG No data
1034942938_1034942945 19 Left 1034942938 7:155243701-155243723 CCCTAACCCAGCAGTACTAGAGG No data
Right 1034942945 7:155243743-155243765 GAAATATAGAGGTGTGAGTTGGG No data
1034942938_1034942944 18 Left 1034942938 7:155243701-155243723 CCCTAACCCAGCAGTACTAGAGG No data
Right 1034942944 7:155243742-155243764 AGAAATATAGAGGTGTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034942938 Original CRISPR CCTCTAGTACTGCTGGGTTA GGG (reversed) Intergenic
No off target data available for this crispr