ID: 1034946622

View in Genome Browser
Species Human (GRCh38)
Location 7:155266631-155266653
Sequence CCCATGGATGCCGGCCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034946622_1034946627 1 Left 1034946622 7:155266631-155266653 CCTCTATGGCCGGCATCCATGGG No data
Right 1034946627 7:155266655-155266677 TTCCCTATCCTCTGGCCTCCAGG No data
1034946622_1034946626 -7 Left 1034946622 7:155266631-155266653 CCTCTATGGCCGGCATCCATGGG No data
Right 1034946626 7:155266647-155266669 CCATGGGCTTCCCTATCCTCTGG No data
1034946622_1034946630 4 Left 1034946622 7:155266631-155266653 CCTCTATGGCCGGCATCCATGGG No data
Right 1034946630 7:155266658-155266680 CCTATCCTCTGGCCTCCAGGTGG No data
1034946622_1034946634 26 Left 1034946622 7:155266631-155266653 CCTCTATGGCCGGCATCCATGGG No data
Right 1034946634 7:155266680-155266702 GATTCAGTCACAGCAGAAGCTGG No data
1034946622_1034946635 27 Left 1034946622 7:155266631-155266653 CCTCTATGGCCGGCATCCATGGG No data
Right 1034946635 7:155266681-155266703 ATTCAGTCACAGCAGAAGCTGGG No data
1034946622_1034946636 30 Left 1034946622 7:155266631-155266653 CCTCTATGGCCGGCATCCATGGG No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034946622 Original CRISPR CCCATGGATGCCGGCCATAG AGG (reversed) Intergenic
No off target data available for this crispr