ID: 1034946624

View in Genome Browser
Species Human (GRCh38)
Location 7:155266640-155266662
Sequence ATAGGGAAGCCCATGGATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034946624_1034946635 18 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946635 7:155266681-155266703 ATTCAGTCACAGCAGAAGCTGGG No data
1034946624_1034946630 -5 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946630 7:155266658-155266680 CCTATCCTCTGGCCTCCAGGTGG No data
1034946624_1034946636 21 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946624_1034946639 30 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946639 7:155266693-155266715 CAGAAGCTGGGAGGGGCAGCTGG No data
1034946624_1034946627 -8 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946627 7:155266655-155266677 TTCCCTATCCTCTGGCCTCCAGG No data
1034946624_1034946634 17 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946634 7:155266680-155266702 GATTCAGTCACAGCAGAAGCTGG No data
1034946624_1034946637 22 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946637 7:155266685-155266707 AGTCACAGCAGAAGCTGGGAGGG No data
1034946624_1034946638 23 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946638 7:155266686-155266708 GTCACAGCAGAAGCTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034946624 Original CRISPR ATAGGGAAGCCCATGGATGC CGG (reversed) Intergenic
No off target data available for this crispr