ID: 1034946632

View in Genome Browser
Species Human (GRCh38)
Location 7:155266670-155266692
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034946632_1034946640 3 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946640 7:155266696-155266718 AAGCTGGGAGGGGCAGCTGGAGG No data
1034946632_1034946638 -7 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946638 7:155266686-155266708 GTCACAGCAGAAGCTGGGAGGGG No data
1034946632_1034946637 -8 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946637 7:155266685-155266707 AGTCACAGCAGAAGCTGGGAGGG No data
1034946632_1034946639 0 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946639 7:155266693-155266715 CAGAAGCTGGGAGGGGCAGCTGG No data
1034946632_1034946636 -9 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946632_1034946641 7 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946641 7:155266700-155266722 TGGGAGGGGCAGCTGGAGGTTGG No data
1034946632_1034946642 19 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946642 7:155266712-155266734 CTGGAGGTTGGAGAAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034946632 Original CRISPR CTGTGACTGAATCCACCTGG AGG (reversed) Intergenic
No off target data available for this crispr