ID: 1034946636

View in Genome Browser
Species Human (GRCh38)
Location 7:155266684-155266706
Sequence CAGTCACAGCAGAAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034946631_1034946636 -2 Left 1034946631 7:155266663-155266685 CCTCTGGCCTCCAGGTGGATTCA No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946622_1034946636 30 Left 1034946622 7:155266631-155266653 CCTCTATGGCCGGCATCCATGGG No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946624_1034946636 21 Left 1034946624 7:155266640-155266662 CCGGCATCCATGGGCTTCCCTAT No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946632_1034946636 -9 Left 1034946632 7:155266670-155266692 CCTCCAGGTGGATTCAGTCACAG No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946628_1034946636 4 Left 1034946628 7:155266657-155266679 CCCTATCCTCTGGCCTCCAGGTG No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946625_1034946636 14 Left 1034946625 7:155266647-155266669 CCATGGGCTTCCCTATCCTCTGG No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data
1034946629_1034946636 3 Left 1034946629 7:155266658-155266680 CCTATCCTCTGGCCTCCAGGTGG No data
Right 1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034946636 Original CRISPR CAGTCACAGCAGAAGCTGGG AGG Intergenic
No off target data available for this crispr