ID: 1034948373

View in Genome Browser
Species Human (GRCh38)
Location 7:155279330-155279352
Sequence ATACATTTTAATCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034948372_1034948373 7 Left 1034948372 7:155279300-155279322 CCAGGGAATGGTCTTACATTCTT No data
Right 1034948373 7:155279330-155279352 ATACATTTTAATCTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034948373 Original CRISPR ATACATTTTAATCTGAAGCC AGG Intergenic
No off target data available for this crispr