ID: 1034948477

View in Genome Browser
Species Human (GRCh38)
Location 7:155280055-155280077
Sequence ATGAGTGACCAGGTCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034948477_1034948482 -4 Left 1034948477 7:155280055-155280077 CCCTCCACGACCTGGTCACTCAT No data
Right 1034948482 7:155280074-155280096 TCATAGATTCACCAGAAATTGGG No data
1034948477_1034948481 -5 Left 1034948477 7:155280055-155280077 CCCTCCACGACCTGGTCACTCAT No data
Right 1034948481 7:155280073-155280095 CTCATAGATTCACCAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034948477 Original CRISPR ATGAGTGACCAGGTCGTGGA GGG (reversed) Intergenic
No off target data available for this crispr