ID: 1034948735

View in Genome Browser
Species Human (GRCh38)
Location 7:155282270-155282292
Sequence CAACAATGCCCCAGTGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034948735_1034948744 7 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948744 7:155282300-155282322 GCCAGGGGGTCACACCCAAAGGG No data
1034948735_1034948747 21 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948747 7:155282314-155282336 CCCAAAGGGAGAGAACCATTAGG No data
1034948735_1034948743 6 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948743 7:155282299-155282321 GGCCAGGGGGTCACACCCAAAGG No data
1034948735_1034948742 -7 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948742 7:155282286-155282308 ATTGTTGTTCTCTGGCCAGGGGG No data
1034948735_1034948741 -8 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948741 7:155282285-155282307 CATTGTTGTTCTCTGGCCAGGGG No data
1034948735_1034948749 27 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948749 7:155282320-155282342 GGGAGAGAACCATTAGGAGTTGG No data
1034948735_1034948751 29 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948751 7:155282322-155282344 GAGAGAACCATTAGGAGTTGGGG No data
1034948735_1034948750 28 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948750 7:155282321-155282343 GGAGAGAACCATTAGGAGTTGGG No data
1034948735_1034948740 -9 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948740 7:155282284-155282306 GCATTGTTGTTCTCTGGCCAGGG No data
1034948735_1034948739 -10 Left 1034948735 7:155282270-155282292 CCCCACGCACTGGGGCATTGTTG No data
Right 1034948739 7:155282283-155282305 GGCATTGTTGTTCTCTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034948735 Original CRISPR CAACAATGCCCCAGTGCGTG GGG (reversed) Intergenic
No off target data available for this crispr