ID: 1034948999

View in Genome Browser
Species Human (GRCh38)
Location 7:155284507-155284529
Sequence ATGAGCCACCTCGCCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034948989_1034948999 13 Left 1034948989 7:155284471-155284493 CCTGCCTCAGCCTCCCAAAGTGC No data
Right 1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG No data
1034948993_1034948999 3 Left 1034948993 7:155284481-155284503 CCTCCCAAAGTGCTGGGATTACA No data
Right 1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG No data
1034948995_1034948999 0 Left 1034948995 7:155284484-155284506 CCCAAAGTGCTGGGATTACAGGC No data
Right 1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG No data
1034948991_1034948999 9 Left 1034948991 7:155284475-155284497 CCTCAGCCTCCCAAAGTGCTGGG No data
Right 1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG No data
1034948987_1034948999 27 Left 1034948987 7:155284457-155284479 CCTCAAGTGATCCACCTGCCTCA No data
Right 1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG No data
1034948988_1034948999 16 Left 1034948988 7:155284468-155284490 CCACCTGCCTCAGCCTCCCAAAG No data
Right 1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG No data
1034948996_1034948999 -1 Left 1034948996 7:155284485-155284507 CCAAAGTGCTGGGATTACAGGCA No data
Right 1034948999 7:155284507-155284529 ATGAGCCACCTCGCCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034948999 Original CRISPR ATGAGCCACCTCGCCTGGAT GGG Intergenic