ID: 1034949832

View in Genome Browser
Species Human (GRCh38)
Location 7:155289832-155289854
Sequence CTGCATCCTCACATGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034949827_1034949832 8 Left 1034949827 7:155289801-155289823 CCACTTTCTAGTTCAGAGATGGC No data
Right 1034949832 7:155289832-155289854 CTGCATCCTCACATGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034949832 Original CRISPR CTGCATCCTCACATGGTGAA GGG Intergenic
No off target data available for this crispr