ID: 1034949835

View in Genome Browser
Species Human (GRCh38)
Location 7:155289838-155289860
Sequence CCTCACATGGTGAAGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034949827_1034949835 14 Left 1034949827 7:155289801-155289823 CCACTTTCTAGTTCAGAGATGGC No data
Right 1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG No data
1034949828_1034949835 -10 Left 1034949828 7:155289825-155289847 CCTTCTCCTGCATCCTCACATGG No data
Right 1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034949835 Original CRISPR CCTCACATGGTGAAGGGGCC AGG Intergenic
No off target data available for this crispr