ID: 1034949835 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:155289838-155289860 |
| Sequence | CCTCACATGGTGAAGGGGCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034949827_1034949835 | 14 | Left | 1034949827 | 7:155289801-155289823 | CCACTTTCTAGTTCAGAGATGGC | No data | ||
| Right | 1034949835 | 7:155289838-155289860 | CCTCACATGGTGAAGGGGCCAGG | No data | ||||
| 1034949828_1034949835 | -10 | Left | 1034949828 | 7:155289825-155289847 | CCTTCTCCTGCATCCTCACATGG | No data | ||
| Right | 1034949835 | 7:155289838-155289860 | CCTCACATGGTGAAGGGGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034949835 | Original CRISPR | CCTCACATGGTGAAGGGGCC AGG | Intergenic | ||
| No off target data available for this crispr | |||||