ID: 1034950168

View in Genome Browser
Species Human (GRCh38)
Location 7:155291511-155291533
Sequence CTGTGGGGCCCTCTTCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034950160_1034950168 0 Left 1034950160 7:155291488-155291510 CCTCTACACACTGACCCTTCCCT No data
Right 1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG No data
1034950159_1034950168 21 Left 1034950159 7:155291467-155291489 CCAGTGTTCACATAGGGCAAGCC No data
Right 1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG No data
1034950158_1034950168 22 Left 1034950158 7:155291466-155291488 CCCAGTGTTCACATAGGGCAAGC No data
Right 1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG No data
1034950155_1034950168 28 Left 1034950155 7:155291460-155291482 CCAATACCCAGTGTTCACATAGG No data
Right 1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034950168 Original CRISPR CTGTGGGGCCCTCTTCCTCC CGG Intergenic
No off target data available for this crispr