ID: 1034950978

View in Genome Browser
Species Human (GRCh38)
Location 7:155297315-155297337
Sequence GGGCCCGAAAAAATCACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034950971_1034950978 27 Left 1034950971 7:155297265-155297287 CCTGGGTGGTGCGGGTGGTTTGC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1034950978 7:155297315-155297337 GGGCCCGAAAAAATCACCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034950978 Original CRISPR GGGCCCGAAAAAATCACCCA AGG Intergenic
902732570 1:18378934-18378956 GGGCCCCAGATAAACACCCATGG - Intergenic
908518617 1:64918570-64918592 GGGCCAGAAAGAATGACCCAGGG + Intronic
916980726 1:170134081-170134103 CAGCCTGAAAAAATGACCCAAGG + Intergenic
917368553 1:174261553-174261575 AGTACTGAAAAAATCACCCAGGG + Intronic
919725263 1:200878315-200878337 GTGCCCCAAGAAAGCACCCAAGG - Intergenic
923095831 1:230774410-230774432 GGGTCCCAAAAATGCACCCAGGG - Intronic
1063956524 10:11272678-11272700 GGCCAAGAAAGAATCACCCATGG - Intronic
1065114232 10:22469033-22469055 GGGCACCAATATATCACCCAGGG - Intergenic
1067059130 10:43068895-43068917 GCGCCCAAATAAATCACCCGGGG - Intergenic
1069135734 10:64762884-64762906 GTGATGGAAAAAATCACCCAAGG - Intergenic
1093080053 12:14800029-14800051 GGGGCAGGAACAATCACCCAAGG - Intronic
1093096078 12:14973692-14973714 GAGCCCATAAATATCACCCAGGG - Intronic
1093668942 12:21849258-21849280 AGGCCAAAAAAAATCAACCAAGG - Intronic
1102746943 12:115257460-115257482 AGGGCCGAAAACATCACCAAGGG + Intergenic
1117303190 14:54448178-54448200 GGACCCGTAAAACTCATCCATGG - Intergenic
1122855391 14:104557522-104557544 GGGACCCACAAAATCACTCATGG + Intronic
1125093642 15:35825941-35825963 AGGCCGGAAAAAATGACACAGGG + Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1128439522 15:67691673-67691695 GAGCCCAAAAAAGCCACCCAAGG - Intronic
1130937901 15:88485587-88485609 GGGCCCCACAGAATCAGCCAAGG - Intergenic
1135938850 16:26803571-26803593 GTGCCTGTAAAAATCACCCATGG - Intergenic
1136585248 16:31180319-31180341 GGGCGCCAAAAAATCCCACACGG - Intronic
1137723091 16:50639271-50639293 GGGGCCGTAAGAATCCCCCAGGG + Exonic
1148562755 17:48615308-48615330 GGGGAAGAAAAAAACACCCAGGG + Intronic
1150016426 17:61561902-61561924 GGGACTGAAAAAAAGACCCAAGG - Intergenic
1151687704 17:75658693-75658715 GGGGCCAAAAAACTCAGCCAGGG + Intronic
1164649336 19:29880819-29880841 GGGCCCTAGAGAAACACCCAGGG + Intergenic
1164691906 19:30217569-30217591 GGGCCCTACAAAATCCCCCAGGG - Intergenic
1166583907 19:43928393-43928415 GGACCAGAAAAAATAACTCATGG + Intronic
1167086017 19:47310152-47310174 GGGCCCGAGAAGATTCCCCAGGG + Intronic
1167474194 19:49690738-49690760 CGGCCCGCCAAAACCACCCACGG - Intergenic
926677623 2:15639414-15639436 GGGCCTGAAAAACTCAACCTAGG - Intergenic
927193697 2:20533797-20533819 GGGCCCCAAAGACTCACCCAGGG + Intergenic
931005811 2:57849582-57849604 GGGCCCGAAAAAAGCACCACAGG + Intergenic
932568242 2:72923009-72923031 GGCCCTGACAAAATCACCCATGG - Intronic
935803038 2:106717590-106717612 GGGCCCGAAAAAAAAACAAAAGG - Intergenic
944399164 2:199305373-199305395 GGGTCCGAAAAAATAACTAATGG + Intronic
944846363 2:203672268-203672290 GGGACAGAAAGAATAACCCAGGG - Intergenic
945130663 2:206568176-206568198 GCGAGCCAAAAAATCACCCAAGG + Intronic
1171937056 20:31285237-31285259 GGGCCCCAAAACATCAGCCCTGG + Intergenic
1176963815 21:15189693-15189715 GGGGCAAAAAAAATCACCCCTGG + Intergenic
1180788726 22:18561809-18561831 TGGGCCCAAAAACTCACCCAAGG + Intergenic
1181233011 22:21433513-21433535 TGGGCCCAAAAACTCACCCAAGG - Intronic
1181245640 22:21501346-21501368 TGGGCCCAAAAACTCACCCAAGG + Intergenic
951379729 3:21968693-21968715 GGGCCCTAAATAATCAGCAATGG + Intronic
951993141 3:28698530-28698552 TGGCCCTAAAAAAATACCCAAGG - Intergenic
952073612 3:29669667-29669689 AGGCTGAAAAAAATCACCCATGG - Intronic
956544387 3:70384082-70384104 GGGCTAAAAAAAATTACCCAGGG + Intergenic
965310579 3:167122667-167122689 GGGTCAGAAAAAATTACACAAGG + Intergenic
969530032 4:7725449-7725471 GGGCCCTGAAAAGGCACCCACGG - Intronic
970586376 4:17518195-17518217 CCTCCCCAAAAAATCACCCAGGG + Intronic
973629866 4:52810386-52810408 GGGGCCGAAGAAGACACCCAAGG + Intergenic
987929012 5:24379181-24379203 GGGCCCGGAACAAACACCCGTGG - Intergenic
999846267 5:155484072-155484094 GGGCCCTAGGAAGTCACCCAGGG - Intergenic
1000751894 5:165106360-165106382 GGTCCAGAAAATATCACCGAAGG - Intergenic
1001122733 5:168993486-168993508 AGGCCAGACAAAATCCCCCATGG + Intronic
1002952242 6:1825505-1825527 GGGCCCAACAAAATCACCTAAGG - Intronic
1009036198 6:58119838-58119860 GGTACAGAACAAATCACCCAAGG + Intergenic
1009212015 6:60873457-60873479 GGTACAGAACAAATCACCCAAGG + Intergenic
1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG + Intronic
1013299159 6:108786952-108786974 GGGCCAGAACAGATGACCCAGGG + Intergenic
1016628310 6:146198553-146198575 GGGACTGAAAAAATCACCATTGG + Intronic
1024221234 7:47288759-47288781 GGGCCAGAAAAATGCTCCCAAGG + Intronic
1028909087 7:96187829-96187851 GGGCCCGACAAATTCAAGCAAGG - Intronic
1033254849 7:139791395-139791417 TGGCCCGTAAAAATCTCCCGTGG - Intronic
1033613504 7:142988347-142988369 GGACCATAGAAAATCACCCAGGG + Intergenic
1034950978 7:155297315-155297337 GGGCCCGAAAAAATCACCCAAGG + Intergenic
1036615122 8:10381842-10381864 GGGACTGGAAAAATCACCCTGGG + Intronic
1036644382 8:10602622-10602644 CGGCCCGAAAAACGCACACACGG - Intergenic
1042254664 8:66790627-66790649 GGGCTCGAATAAAACAGCCATGG + Intronic
1046179312 8:110622315-110622337 GGGTCAGAAAAAATAACTCATGG + Intergenic
1049206314 8:141365280-141365302 GGGCCAGAAACACCCACCCAGGG - Intronic
1051356018 9:16240255-16240277 GGCCCTGAGAAACTCACCCAGGG + Intronic
1186134924 X:6509056-6509078 GGGTCAGAAAAAATAACTCAGGG + Intergenic
1189633081 X:42975651-42975673 AGGACCGACAAGATCACCCATGG + Intergenic
1193420763 X:81279928-81279950 GGGGCTTAAAAATTCACCCAAGG - Intronic
1193548788 X:82862975-82862997 GGGCTCCAAAAAATCATCCATGG - Intergenic
1196179975 X:112679141-112679163 GGGTGAGGAAAAATCACCCATGG - Intronic
1199374353 X:147089209-147089231 GGGCCAGAGAAAATTACACAAGG + Intergenic