ID: 1034952052

View in Genome Browser
Species Human (GRCh38)
Location 7:155305223-155305245
Sequence GGTTAGGCTTAGAACCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034952052_1034952058 24 Left 1034952052 7:155305223-155305245 CCTCTGAGGTTCTAAGCCTAACC No data
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034952052 Original CRISPR GGTTAGGCTTAGAACCTCAG AGG (reversed) Intronic