ID: 1034952052

View in Genome Browser
Species Human (GRCh38)
Location 7:155305223-155305245
Sequence GGTTAGGCTTAGAACCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034952052_1034952058 24 Left 1034952052 7:155305223-155305245 CCTCTGAGGTTCTAAGCCTAACC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034952052 Original CRISPR GGTTAGGCTTAGAACCTCAG AGG (reversed) Intronic
901447077 1:9315126-9315148 GGCAAGGCTGAGAAGCTCAGCGG + Intronic
902250169 1:15149317-15149339 GGTTACCCTTAGAAACTGAGGGG - Intergenic
903051128 1:20602018-20602040 GGTTAGGATGAGAAGATCAGTGG + Intronic
908717432 1:67085252-67085274 TGTTTTGCTTAGGACCTCAGAGG - Intergenic
909625993 1:77716633-77716655 GGTTAGTCTTAGGACCACATGGG + Intronic
909823649 1:80098256-80098278 GGTAAGCCTTGGAACCTCACTGG - Intergenic
916370072 1:164082047-164082069 GCTGAGGCAAAGAACCTCAGAGG - Intergenic
918092037 1:181305437-181305459 AGTGAGGCTCAGAACCTAAGAGG - Intergenic
1065263430 10:23950652-23950674 GGTTAGGGTTAGAAGCTGGGAGG + Intronic
1071048970 10:81422453-81422475 AGTCAGGCTTAGAACTTCAGTGG - Intergenic
1075008972 10:118851985-118852007 GGTTAGGCTGAGTCCCTAAGGGG - Intergenic
1083610867 11:64003711-64003733 GGTTGGGCTCCCAACCTCAGTGG + Intronic
1085681037 11:78575033-78575055 GGTGAGGCTGAGAAACTGAGAGG + Intergenic
1089644651 11:119870716-119870738 TGTTATGCTTGGAACCTAAGAGG - Intergenic
1090803451 11:130188617-130188639 GGCCAGGCTTACAAACTCAGTGG - Exonic
1092228363 12:6763738-6763760 GGTTAGCCTCAGAGCCTCTGGGG - Intronic
1098102566 12:67033959-67033981 GATTAGGCTTAGAACTCCTGAGG - Intergenic
1098150627 12:67542819-67542841 GGATGGGCTTAGAGCCTCATTGG + Intergenic
1103198680 12:119068798-119068820 GGTGAGGCTTAGAAACAGAGAGG + Intronic
1120942096 14:89958363-89958385 GGTTAGGCTGACAACCGAAGGGG + Intronic
1121468886 14:94136641-94136663 AGTTTGGCTCAGAACCCCAGTGG - Intergenic
1129171734 15:73812170-73812192 TGTCAGGCTTAGAGCTTCAGGGG - Intergenic
1136480098 16:30535781-30535803 GGTAAGGCTGAGAAAGTCAGAGG + Intronic
1138869050 16:60858672-60858694 GGTTAAGCTTAGGAACTTAGAGG + Intergenic
1148236585 17:45973230-45973252 CATGAGGCTAAGAACCTCAGCGG - Intronic
1152214123 17:79022712-79022734 CGCTAGGCTTAGAAGATCAGGGG - Intergenic
1155794301 18:30015329-30015351 AGTTAAGCTTTGTACCTCAGTGG - Intergenic
1161170068 19:2808114-2808136 AGGGAGGTTTAGAACCTCAGAGG + Intronic
1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG + Intergenic
1164127100 19:22328473-22328495 TGTTAGATTTAGAACCTCAATGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
925657474 2:6165407-6165429 GGTTGGGCTTAGAAGCTGGGGGG + Intergenic
933493903 2:83023342-83023364 GGTTAAGCTTTGAATATCAGTGG - Intergenic
933974280 2:87495693-87495715 TCTTAGGCTGAGAACCTCAAAGG + Intergenic
936319546 2:111455130-111455152 TCTTAGGCTGAGAACCTCAAAGG - Intergenic
941446477 2:165606893-165606915 TGTGAGGCTTAGAACCTCTAGGG + Intronic
942298593 2:174540489-174540511 AGTTATGCTTAGGACCTCATTGG + Intergenic
942922830 2:181397538-181397560 TGATAGGCTTAGAGCCTCTGTGG - Intergenic
943993125 2:194722898-194722920 TGTTAGGCTAAAAACATCAGTGG - Intergenic
1169020524 20:2327682-2327704 GGTCAGGCTTGGGAGCTCAGAGG + Intronic
1169367610 20:5003604-5003626 GGATAGACTTAAAAGCTCAGGGG - Intronic
1178385029 21:32142110-32142132 GGTGGGGCTGAGAACCTCTGTGG - Intergenic
1179439378 21:41382476-41382498 GGTCAGGTCTGGAACCTCAGGGG - Exonic
1182529379 22:30943623-30943645 GGCCAGGCTAAGCACCTCAGGGG + Intronic
1182955956 22:34426650-34426672 TGTTAGGCTTAGTACCTGGGTGG + Intergenic
957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG + Intronic
957638492 3:82817613-82817635 GGCTAGGATTTGAAACTCAGGGG - Intergenic
962969486 3:140385675-140385697 GTTTAAGGTTAGAACATCAGGGG - Intronic
965783186 3:172309699-172309721 GGTTAGTAATAAAACCTCAGGGG - Intronic
969392698 4:6901811-6901833 GGGGAGGCTTAGAACATCTGTGG + Intergenic
979503209 4:121463340-121463362 GGTTAGCCTGGGAACCTGAGTGG - Intergenic
979721137 4:123901939-123901961 GGATGGCCTTAGAAACTCAGAGG + Intergenic
981107743 4:140900367-140900389 GGTGATGCTGATAACCTCAGAGG + Intronic
993160679 5:84286871-84286893 AGTTCAGCTTAAAACCTCAGTGG - Intronic
994074850 5:95639285-95639307 GCATAGGCTTAGAATCTGAGAGG + Intergenic
996833323 5:127764068-127764090 AATTTGGCTTAGGACCTCAGAGG - Intergenic
1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG + Intergenic
1033304580 7:140215076-140215098 GGTGCTGCTTAGAACCCCAGTGG - Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1037741366 8:21611768-21611790 GGTCATGCTTAGATCCTGAGTGG + Intergenic
1040301909 8:46192408-46192430 GGTGGGCCTTAGAAACTCAGGGG + Intergenic
1045251685 8:100487889-100487911 GGGTAGGAGTTGAACCTCAGGGG - Intergenic
1047200404 8:122760456-122760478 GGCTGGGCTTGAAACCTCAGAGG + Intergenic
1055515902 9:77032606-77032628 GCTAAGCCTCAGAACCTCAGGGG - Intergenic
1056769125 9:89464357-89464379 GGTGGGGCTGAGGACCTCAGGGG + Intronic
1057502550 9:95607230-95607252 GGTTTGGCTTGGAACAGCAGTGG - Intergenic
1058858123 9:109086684-109086706 GGTTAGATTTAGAGCCTTAGTGG - Intronic
1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG + Intergenic
1061661534 9:132133439-132133461 GGTTGGGCATAGAACCAGAGCGG + Intergenic
1062085997 9:134648832-134648854 GCTCAGGCTCAGAGCCTCAGAGG - Intronic
1196535638 X:116840217-116840239 GGTTAGGTTTTAAACTTCAGGGG + Intergenic
1196601581 X:117606899-117606921 GGTGAGGCTAAGAACCAAAGAGG + Intergenic
1197685844 X:129438730-129438752 GGTTGGGCTCAGCACCTCATGGG - Intergenic