ID: 1034952058

View in Genome Browser
Species Human (GRCh38)
Location 7:155305270-155305292
Sequence AATACTTAAATCCTTACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034952054_1034952058 3 Left 1034952054 7:155305244-155305266 CCCGCCTACCACTGTTTTTATTC 0: 1
1: 0
2: 0
3: 20
4: 349
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207
1034952052_1034952058 24 Left 1034952052 7:155305223-155305245 CCTCTGAGGTTCTAAGCCTAACC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207
1034952055_1034952058 2 Left 1034952055 7:155305245-155305267 CCGCCTACCACTGTTTTTATTCA 0: 1
1: 0
2: 2
3: 33
4: 307
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207
1034952057_1034952058 -5 Left 1034952057 7:155305252-155305274 CCACTGTTTTTATTCATAAATAC 0: 1
1: 0
2: 1
3: 40
4: 450
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207
1034952056_1034952058 -1 Left 1034952056 7:155305248-155305270 CCTACCACTGTTTTTATTCATAA 0: 1
1: 0
2: 2
3: 37
4: 387
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207
1034952053_1034952058 8 Left 1034952053 7:155305239-155305261 CCTAACCCGCCTACCACTGTTTT 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034952058 Original CRISPR AATACTTAAATCCTTACCTC TGG Intronic
901940735 1:12659800-12659822 AATACATAAATAATTACCTAGGG - Intronic
903432170 1:23314138-23314160 AATGCTTAAATCATTAAATCAGG + Intronic
905552755 1:38857464-38857486 ATTACTTGAATGCCTACCTCAGG + Intronic
906391905 1:45424967-45424989 AAAACTGAAAGCCTTTCCTCTGG + Intronic
909523961 1:76601443-76601465 ACTACATAAATCATTAGCTCCGG + Intronic
909668003 1:78157690-78157712 AATACTTAAATTCTTCCCTATGG - Intergenic
910942930 1:92556727-92556749 TATATTTAAATCCATAGCTCAGG + Intronic
912864083 1:113241428-113241450 AATAGTTAAATCCTTCTGTCTGG + Intergenic
913185584 1:116367975-116367997 CATACTCCAATCCTTAACTCTGG - Intergenic
917309480 1:173663665-173663687 AATGCTTAATTCCTTCCCACTGG + Intronic
918603012 1:186385813-186385835 AATAAATAAATCCTTTTCTCAGG - Intronic
919158123 1:193793192-193793214 AATACATGAATCCTGGCCTCTGG + Intergenic
921797789 1:219367776-219367798 TATACTTTAAACATTACCTCAGG - Intergenic
922028234 1:221773395-221773417 GCTACATAAATTCTTACCTCCGG - Intergenic
922714145 1:227857928-227857950 AATATGTAAATGATTACCTCAGG + Intergenic
923855021 1:237837289-237837311 ATTACTTCAATCCTTGCCTCAGG - Intergenic
924441389 1:244088129-244088151 CATCCTCAAATCCTTATCTCAGG + Intergenic
924668900 1:246103043-246103065 AAGACATAAATCCTGCCCTCAGG - Intronic
1063292353 10:4762217-4762239 AAAACTTGCATCCTTACCTGTGG + Intergenic
1064974689 10:21101247-21101269 GATACTCAAATCCTTCCCTGTGG + Intronic
1065172924 10:23049851-23049873 ACTACTAAAATCCCCACCTCAGG + Intergenic
1066279451 10:33901105-33901127 AAGACTGAAAACATTACCTCAGG + Intergenic
1066662483 10:37750314-37750336 AACATTTAAATGCTTACCTGTGG + Intergenic
1068756171 10:60656520-60656542 AATAATTATTTCCTTCCCTCTGG + Intronic
1069240882 10:66137728-66137750 AATCCTGAACTCCTGACCTCAGG - Intronic
1071873997 10:89824131-89824153 AAATTTTAAAACCTTACCTCAGG + Intergenic
1072307214 10:94119293-94119315 AATACTTAAAAAAATACCTCTGG + Intronic
1072815979 10:98509813-98509835 AATGCTCAAATGCTTAACTCGGG + Intronic
1075583328 10:123639018-123639040 AATACTTAAATACTGACTTTGGG - Intergenic
1078310850 11:10240146-10240168 CAGACTTAAAACCTTATCTCAGG + Intronic
1079486946 11:20945135-20945157 TGTACTGAAATCCTTAGCTCAGG - Intronic
1082897616 11:58209388-58209410 AAAACTTAAATTCTCAGCTCAGG - Intergenic
1083082927 11:60112380-60112402 AATACTAAAATCCCTACCCAGGG - Intergenic
1083240284 11:61382872-61382894 AATCCTGAACTCCTGACCTCAGG - Intergenic
1085926127 11:81023814-81023836 AATACTTAAATGCTCATCACTGG + Intergenic
1086212820 11:84341519-84341541 AATAATTAAATCATAATCTCTGG - Intronic
1086215019 11:84368411-84368433 AAATCTCAAATCCTTACCTTGGG - Intronic
1087726166 11:101719647-101719669 TATACTTGAATCCTTGTCTCAGG + Intronic
1092988981 12:13876545-13876567 AATACTTAAATTCTAATCCCAGG + Intronic
1093558911 12:20514100-20514122 AATAATTAAATCCACATCTCTGG + Intronic
1093995825 12:25641462-25641484 AAGGCTTAAATACTTACCTCAGG - Intronic
1094011696 12:25816532-25816554 TGTACTCAAATCCTTATCTCAGG + Intergenic
1094207904 12:27859937-27859959 TATACTTAAATCCCTGTCTCAGG + Intergenic
1095717655 12:45365241-45365263 AAACCTTAATCCCTTACCTCTGG - Intronic
1096301556 12:50432641-50432663 AATACTGAACTCCTCACCTCAGG - Intronic
1096819794 12:54224970-54224992 CAGACTTAAATTCTTACCTAAGG + Intergenic
1097490677 12:60266310-60266332 AATAATTAAATGCTTTCATCTGG - Intergenic
1097569154 12:61309519-61309541 TATGCCTAAATCCTTTCCTCTGG - Intergenic
1097696776 12:62782388-62782410 AATACCTAACTCCTGTCCTCAGG + Intronic
1098618549 12:72560943-72560965 AATAGTTAAATCCTGGTCTCTGG + Intronic
1099756068 12:86850455-86850477 AATACTAATTTCCTTACCTTTGG + Intergenic
1101861568 12:108486497-108486519 AATACATAAATCCTTGCCTCAGG + Intergenic
1103226175 12:119290045-119290067 CATACTCAAATCCTGATCTCAGG - Intergenic
1104039484 12:125120452-125120474 AATATTTAAATCCTGACATTTGG + Intronic
1104317489 12:127717609-127717631 ATTACTAAAATCCATATCTCTGG + Intergenic
1105219991 13:18316826-18316848 ACTCCCTAACTCCTTACCTCAGG - Intergenic
1106949701 13:34869845-34869867 AATGGTTAAATCCCTACCCCAGG + Intergenic
1107443747 13:40451313-40451335 AATAATTAAATCCTTCCCAGTGG + Intergenic
1107625982 13:42284597-42284619 AAGACTTAAATATTTACCTAAGG - Intronic
1110051489 13:70906897-70906919 TATCCTTAACTCCTTGCCTCAGG + Intergenic
1111850765 13:93571582-93571604 AATAGTTAAATCCTTCCCTGTGG - Intronic
1112421849 13:99259397-99259419 GTTACTTAAATCCTTGCCTTTGG + Intronic
1114880600 14:26780704-26780726 AATATTTATATCCTAATCTCTGG - Intergenic
1114885341 14:26842881-26842903 AATACTTTGATACTTACATCAGG + Intergenic
1114891340 14:26927880-26927902 AGTATTGAAATCCTTTCCTCTGG + Intergenic
1114901682 14:27068240-27068262 AATATTTAAATCCTTATGTAAGG + Intergenic
1115731988 14:36280175-36280197 CATAATTAAATACTTACTTCTGG - Intergenic
1115776592 14:36722004-36722026 CATACTGAAATTCATACCTCTGG - Intronic
1117225683 14:53656132-53656154 AAAACTTAAAGACTTGCCTCTGG - Intergenic
1119027040 14:71161903-71161925 TATACTTAAATCCTTACTTTTGG - Intergenic
1122403909 14:101486545-101486567 AATAATAAAATCTTTTCCTCAGG - Intergenic
1124786253 15:32683634-32683656 AATAATCAAATACTTACCTACGG - Intronic
1125350430 15:38761301-38761323 AATAGTTGAATCCTTACCTTAGG - Intergenic
1126719196 15:51558317-51558339 TACACTTGAATCCTTATCTCAGG + Intronic
1126788764 15:52201518-52201540 AATACTAAAATACTTTCTTCAGG + Intronic
1128610240 15:69067289-69067311 CATACTTGAATCCTCAGCTCTGG - Intergenic
1130378381 15:83350734-83350756 AGTAATTAAATCCTTAATTCAGG + Intergenic
1133158763 16:3894977-3894999 GATACATAAATACTTACCACGGG + Intergenic
1137786701 16:51143688-51143710 AATACCTAAATACTAACTTCTGG + Intronic
1139900529 16:70324682-70324704 AATTCATAAATCCTTACCTGGGG - Exonic
1143370573 17:6436344-6436366 AATACAAAACTCCTGACCTCAGG - Intergenic
1144398958 17:14875935-14875957 AGGCCTTAAATCCTCACCTCTGG - Intergenic
1150078650 17:62216737-62216759 TATACTTAAAGCCTTAACTCAGG + Intergenic
1151077516 17:71290577-71290599 AATACTGACATTCTAACCTCAGG - Intergenic
1153990003 18:10388185-10388207 AGTACTTTAATCCTTGACTCTGG - Intergenic
1155182168 18:23357446-23357468 AATGCTTAATTCCTTTTCTCCGG - Intronic
1156385899 18:36604739-36604761 AATAGTTAAATCTCTTCCTCTGG - Intronic
1158767748 18:60475297-60475319 ACTTCTTTGATCCTTACCTCAGG - Intergenic
1159572188 18:70128745-70128767 AACACTTAAATCCTTTCTTGAGG + Intronic
1168033035 19:53696528-53696550 CATTCTTGAATCCTGACCTCAGG + Intergenic
926470545 2:13251153-13251175 AAAATTCAAATCCTGACCTCCGG - Intergenic
926821564 2:16856896-16856918 AAAACTTTATTCCATACCTCAGG - Intergenic
926842356 2:17095834-17095856 AAGACCTAAATCCTTACTTAAGG - Intergenic
931183017 2:59922476-59922498 AATACTTAAATTCTGTTCTCTGG - Intergenic
931564874 2:63605388-63605410 AATCACTAAATCCTTACCTCTGG - Exonic
932280790 2:70489997-70490019 AACAATTAAATCATTATCTCTGG - Intronic
932949302 2:76273786-76273808 AACACTCAAATCCTATCCTCAGG - Intergenic
934088638 2:88531383-88531405 AATAATTAAATCCATAAGTCGGG - Intergenic
934330556 2:92062549-92062571 AAAATTTAGATCCTTAACTCAGG + Intergenic
934578585 2:95419539-95419561 AGCACTTCAATCCTTGCCTCAGG - Intergenic
934600855 2:95657168-95657190 AGCACTTCAATCCTTGCCTCAGG + Intergenic
936534233 2:113299315-113299337 AGCACTTCAATCCTTGCCTCAGG + Intergenic
937268144 2:120630143-120630165 AATCCTTAAGTCCTGACCTGGGG + Intergenic
938278279 2:130047439-130047461 TATACTTGAATCTTTGCCTCAGG - Intergenic
938329250 2:130438244-130438266 TATACTTGAATCTTTGCCTCAGG - Intergenic
938360696 2:130683249-130683271 TATACTTGAATCTTTGCCTCAGG + Intergenic
938437098 2:131289947-131289969 TATACTTGAATCTTTGCCTCAGG + Intronic
940314685 2:152315341-152315363 AAAACTGAAAGCCTTTCCTCTGG - Intergenic
941794155 2:169581723-169581745 CATTTTTAAATCCTTACCTATGG + Intergenic
941804869 2:169701825-169701847 AACCCTGAAATACTTACCTCTGG - Intronic
942006266 2:171703096-171703118 ATTACTTACATTTTTACCTCTGG + Intronic
942222846 2:173788247-173788269 GGCACTCAAATCCTTACCTCAGG + Intergenic
943370052 2:187004090-187004112 AATACTAAAACACTTACCTGAGG - Intergenic
944230705 2:197389173-197389195 AATACTTAAATGTCTACCTTGGG - Intergenic
944284610 2:197934577-197934599 TAAACTTAAATTCTGACCTCTGG + Intronic
944858202 2:203788370-203788392 AGGACTTAAATCCCTCCCTCTGG + Intergenic
946450966 2:219778651-219778673 AATGCTTAAAATATTACCTCTGG + Intergenic
947554272 2:231076096-231076118 AATCCTTAGATCCTTACTTCAGG + Intronic
1169495825 20:6113857-6113879 TGTACTTGAATCCTTATCTCAGG + Intronic
1169503773 20:6186509-6186531 ACTACTGTAATCCCTACCTCAGG - Intergenic
1169738378 20:8862834-8862856 TATACTCAAATCCTCATCTCAGG - Intronic
1170776001 20:19375130-19375152 TGTACTGAAATCCTTGCCTCAGG + Intronic
1171022948 20:21603212-21603234 GATGCTGAAATCCCTACCTCTGG - Intergenic
1171176552 20:23054399-23054421 AATTCTTTCATCCTTACCACAGG - Intergenic
1172882750 20:38212559-38212581 GATCCTTAAATCCTCATCTCAGG + Exonic
1178544731 21:33483299-33483321 AATACTTAAATCAGTACATTTGG - Intergenic
1179044467 21:37832224-37832246 AATACTAAGATCCTTATCTCAGG - Intronic
1181587259 22:23860021-23860043 AACAATTAACTCCTTCCCTCAGG - Intronic
1183092265 22:35530689-35530711 AATCCTGAACTCCTGACCTCAGG + Intergenic
1183578098 22:38705226-38705248 AATAATTAAATGCTGACCTTAGG - Intergenic
951170057 3:19531322-19531344 CACACTTAAATCATTACCCCAGG - Intronic
952070900 3:29634707-29634729 TGTAGTTAAATCCTTATCTCAGG + Intronic
952311782 3:32197144-32197166 AATACTTATATTTTTACCTTTGG - Intergenic
953300031 3:41764815-41764837 AAGCCTTCAGTCCTTACCTCAGG - Intronic
954083670 3:48227254-48227276 CTCACTTAAATCCTTAACTCAGG + Intergenic
954980239 3:54739201-54739223 AGTCCTGAAATCCTGACCTCAGG - Intronic
956015495 3:64878209-64878231 AATACTTAATTCTTTACCTGGGG - Intergenic
956324615 3:68037640-68037662 AATATTTTAATCTTTTCCTCTGG + Intronic
958131888 3:89437439-89437461 AAAAATTAATTCCTTTCCTCTGG + Intronic
958589891 3:96142754-96142776 CATACCTAAATCCCTACCACAGG + Intergenic
960431721 3:117577340-117577362 CATACTTAATTCCTTGCCTTGGG + Intergenic
960456748 3:117881820-117881842 ATTACTTAAATTCTGATCTCAGG + Intergenic
962920481 3:139946128-139946150 AATACTGAAATCCTGCCCTTAGG + Intronic
964355156 3:155844301-155844323 AATACTTAAATATTTACCAAAGG + Intronic
965223277 3:165954880-165954902 AATAATTACATCTTTTCCTCTGG - Intergenic
965734386 3:171805428-171805450 AATATTGAAATGCTTCCCTCTGG + Intronic
966271821 3:178116974-178116996 AATATATAATTTCTTACCTCTGG + Intergenic
970185551 4:13447576-13447598 AATACTTAAATTCTAACTTCAGG + Intronic
970233571 4:13935421-13935443 AATACTAACACTCTTACCTCTGG - Intergenic
970764307 4:19529091-19529113 AATACTGATTTCCTTTCCTCTGG - Intergenic
970996514 4:22273704-22273726 AATACTTACAGCTTTTCCTCTGG - Intergenic
972176221 4:36409705-36409727 AATACTTATATCCTTGCCTGAGG + Intergenic
975755054 4:77563477-77563499 CATAATTAAATCCTTATCTCAGG + Intronic
975992662 4:80275169-80275191 AATATTTAAATTATTACTTCTGG - Intronic
976870715 4:89790165-89790187 AATAACAAAATCCTTATCTCAGG + Intronic
977048253 4:92093594-92093616 AATATTTAAAGCCATACTTCAGG - Intergenic
977146934 4:93454506-93454528 AATACTTAAATACTTAGCACAGG + Intronic
977630389 4:99236300-99236322 TCTACTTAGATCCTTTCCTCTGG + Intergenic
977786425 4:101040404-101040426 AATACTTTAATACTTTCATCTGG - Intronic
978184452 4:105840783-105840805 AATAATCAGGTCCTTACCTCAGG + Intronic
978611638 4:110547016-110547038 TATACTTAACTACTTAACTCAGG + Intronic
978634341 4:110785797-110785819 AAGAATTAAATCCTTGCCTTTGG - Intergenic
979901286 4:126221650-126221672 AAAACTTACTTCCTTAACTCTGG + Intergenic
980104103 4:128570670-128570692 AGTACTTTAATCCTTGCTTCAGG + Intergenic
982343812 4:154333679-154333701 CATACATAAATCCTTACCATTGG + Intronic
983664081 4:170163341-170163363 ATTCCTTAGATCCTTGCCTCTGG - Intergenic
990866391 5:60385160-60385182 CATGCTTAAATTCTTAGCTCAGG - Intronic
990901073 5:60749634-60749656 AATGATTAAATCATTACTTCTGG - Intergenic
991251797 5:64570487-64570509 AATACATAAATCATTACATTAGG + Intronic
991731685 5:69595984-69596006 AATACTTTCATCTTTGCCTCAGG - Intergenic
991808117 5:70451122-70451144 AATACTTTCATCTTTGCCTCAGG - Intergenic
991863267 5:71031883-71031905 AATACTTTCATCTTTGCCTCAGG + Intergenic
992695993 5:79287904-79287926 AAAACTTAAATCCCTTACTCAGG - Intronic
993865460 5:93189249-93189271 AATACTTACAGCCTTTTCTCTGG - Intergenic
993974990 5:94468459-94468481 AATACTTTAATTCTTATCTCAGG + Intronic
995188879 5:109299458-109299480 TGTACTTAAATACTTATCTCAGG + Intergenic
996375581 5:122803194-122803216 AATTCTTAAATCTTTACATCTGG - Intronic
998109213 5:139488171-139488193 AATACTGAAATCCTAATCTATGG - Intergenic
998215080 5:140231850-140231872 AATACCAAAATCCTTAACTTGGG - Intronic
1000733956 5:164874605-164874627 GATACTGATATCCTTACCCCAGG - Intergenic
1001496613 5:172192396-172192418 TACACTCAAATCCTTGCCTCAGG - Intergenic
1001857041 5:175021965-175021987 GATACTTGAATCCTAATCTCTGG - Intergenic
1004992959 6:21159803-21159825 AAAAATTAAACCCTTACTTCAGG + Intronic
1007072203 6:39046086-39046108 TGTCCTTAAATCCTTATCTCAGG - Intergenic
1008142131 6:47844190-47844212 ACTTCTAAAATCCTTACTTCTGG + Intergenic
1008851356 6:56026410-56026432 CTTACTTTAGTCCTTACCTCTGG - Intergenic
1010244052 6:73646447-73646469 CATTCTTAAATCCTTTCTTCAGG + Intronic
1012265962 6:97143547-97143569 ACTACTTATTTCCTTACCTCTGG - Exonic
1012436201 6:99217553-99217575 AAAAATTAAATCCCTACATCAGG + Intergenic
1014637942 6:123872175-123872197 TTTACTTGAATCCTCACCTCAGG - Intronic
1014728767 6:125006335-125006357 AATACTCAACTCCTAACCACAGG + Intronic
1015806701 6:137117099-137117121 CATACATAAATCTTTTCCTCTGG - Intergenic
1020313619 7:6888328-6888350 CATACTTAGATCCTGACCTGGGG + Intergenic
1020717526 7:11694937-11694959 AATATTCAATTCTTTACCTCAGG - Intronic
1021073470 7:16272669-16272691 ACTACATAAATCCTTTCCTAAGG + Intronic
1021314934 7:19136756-19136778 CATACTTCAATCCAAACCTCAGG - Intergenic
1022407051 7:30100238-30100260 TATATTTAAATCCTAATCTCTGG - Intronic
1028233576 7:88333287-88333309 TTCACTTAAATCCTTGCCTCAGG + Intergenic
1028681455 7:93539166-93539188 ATTTCATAAATCCTTACCCCAGG - Intronic
1028833187 7:95347421-95347443 AATTATTAAATCCTTATATCAGG + Intergenic
1031529453 7:122858417-122858439 AATCCTTAGATCTTTACCTCAGG - Intronic
1033022460 7:137740096-137740118 CCTACTTAAATCCTTACATCAGG + Intronic
1033804740 7:144940950-144940972 AATACATAAATCCAGTCCTCAGG + Intergenic
1034899085 7:154896367-154896389 ACTGCTCAAATCCTGACCTCTGG - Intergenic
1034952058 7:155305270-155305292 AATACTTAAATCCTTACCTCTGG + Intronic
1038934830 8:32237587-32237609 AAGACTTACATACTTATCTCTGG - Intronic
1040794421 8:51273460-51273482 AACACTTGAATCCTGGCCTCAGG - Intergenic
1040957906 8:52998201-52998223 AATACTTAACTCCTGACCTGGGG + Intergenic
1042273547 8:66980031-66980053 AATACTAGAATCCTTACCCTAGG + Intronic
1043262196 8:78216095-78216117 AATACTTAAATGCTTGCCTATGG - Intergenic
1044049130 8:87478116-87478138 AATACTTACATCCTTATATTAGG - Intronic
1044248046 8:89973315-89973337 AATACTTAAATCTATACTTGAGG - Intronic
1044927434 8:97221571-97221593 TATACTGAAATCCTAACCCCTGG + Intergenic
1045557117 8:103225430-103225452 ATTACTTACATCCTTATCTCAGG - Intronic
1046168029 8:110465217-110465239 ATTACTTCAATTCTTACCTAAGG + Intergenic
1046258767 8:111738030-111738052 AATAATTAATTCATTACCTTTGG - Intergenic
1046874965 8:119244261-119244283 AATAGTCAAATACTTACCTTTGG + Exonic
1049914901 9:307722-307744 TATACTGATATCCTTTCCTCTGG - Intronic
1050136661 9:2472898-2472920 TATACTTCAATCCTTGTCTCAGG - Intergenic
1052022941 9:23545316-23545338 AATACTCTACTCCTGACCTCAGG - Intergenic
1052590744 9:30490631-30490653 AAGACTTAAATCCCTAATTCAGG - Intergenic
1055012103 9:71578249-71578271 CATACTTCAATTCTTACCTGTGG + Intergenic
1055509260 9:76979044-76979066 AATCTTGAAATCCTGACCTCAGG - Intergenic
1055536779 9:77255075-77255097 AATACTGAAAGCTTTTCCTCTGG - Intronic
1057950360 9:99364904-99364926 TGTACCTAAATCCTTGCCTCAGG - Intergenic
1186034377 X:5404994-5405016 AATAATTAAATCCTTTCCACTGG + Intergenic
1186268081 X:7853290-7853312 AATTGTTAAATCCTTACCTTTGG + Intergenic
1186305525 X:8252532-8252554 AATACTTACATCCTGGCCTATGG - Intergenic
1186849616 X:13567880-13567902 TTTACTTGAATCCTTGCCTCAGG + Intergenic
1189097639 X:38157129-38157151 TACACTTGAATCCTTATCTCAGG - Intronic
1189684521 X:43550103-43550125 GCTACTCAAATCCTTGCCTCAGG + Intergenic
1190545387 X:51520494-51520516 AAAACTTAGAATCTTACCTCTGG + Intergenic
1192024156 X:67430863-67430885 AATACCTTAAGCTTTACCTCAGG - Intergenic
1192374335 X:70543959-70543981 GATACACAAATACTTACCTCTGG - Intronic
1196694939 X:118601460-118601482 AACTTTTAAATCCTTTCCTCAGG + Intronic
1201513417 Y:14790495-14790517 AACACTTAAATACTTACATTTGG - Intronic