ID: 1034954495

View in Genome Browser
Species Human (GRCh38)
Location 7:155326249-155326271
Sequence AATAGAAACCTCCTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034954493_1034954495 -3 Left 1034954493 7:155326229-155326251 CCACCTGGGTAAGCTGTAATAAT No data
Right 1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG No data
1034954488_1034954495 26 Left 1034954488 7:155326200-155326222 CCTGTTCCTGCTGCTGTAACAAA No data
Right 1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG No data
1034954494_1034954495 -6 Left 1034954494 7:155326232-155326254 CCTGGGTAAGCTGTAATAATAGA No data
Right 1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG No data
1034954489_1034954495 20 Left 1034954489 7:155326206-155326228 CCTGCTGCTGTAACAAAACACCA No data
Right 1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG No data
1034954492_1034954495 0 Left 1034954492 7:155326226-155326248 CCACCACCTGGGTAAGCTGTAAT No data
Right 1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034954495 Original CRISPR AATAGAAACCTCCTTCTCAC AGG Intergenic
No off target data available for this crispr