ID: 1034963112

View in Genome Browser
Species Human (GRCh38)
Location 7:155374427-155374449
Sequence GCGCGTGTGGGCGGAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034963103_1034963112 9 Left 1034963103 7:155374395-155374417 CCGTGGGCCAGGTGCGGGTTTCA No data
Right 1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG No data
1034963102_1034963112 10 Left 1034963102 7:155374394-155374416 CCCGTGGGCCAGGTGCGGGTTTC No data
Right 1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG No data
1034963094_1034963112 27 Left 1034963094 7:155374377-155374399 CCCGGCTTTTCCGGCTACCCGTG No data
Right 1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG No data
1034963104_1034963112 2 Left 1034963104 7:155374402-155374424 CCAGGTGCGGGTTTCAGCACGCG No data
Right 1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG No data
1034963095_1034963112 26 Left 1034963095 7:155374378-155374400 CCGGCTTTTCCGGCTACCCGTGG No data
Right 1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG No data
1034963099_1034963112 17 Left 1034963099 7:155374387-155374409 CCGGCTACCCGTGGGCCAGGTGC No data
Right 1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034963112 Original CRISPR GCGCGTGTGGGCGGAGGCGC CGG Intergenic