ID: 1034963202

View in Genome Browser
Species Human (GRCh38)
Location 7:155374872-155374894
Sequence AGGGGGCTTCCGTGGGTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034963202_1034963210 7 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963210 7:155374902-155374924 GTTTGCGTCCTCGCCGCCACCGG No data
1034963202_1034963218 26 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963218 7:155374921-155374943 CCGGCTTGGTAGGGTCCTTTAGG No data
1034963202_1034963219 27 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963219 7:155374922-155374944 CGGCTTGGTAGGGTCCTTTAGGG No data
1034963202_1034963213 16 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963213 7:155374911-155374933 CTCGCCGCCACCGGCTTGGTAGG No data
1034963202_1034963211 12 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data
1034963202_1034963214 17 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963214 7:155374912-155374934 TCGCCGCCACCGGCTTGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034963202 Original CRISPR AGGGGGCTTCCGTGGGTCCG CGG (reversed) Intergenic
No off target data available for this crispr