ID: 1034963210

View in Genome Browser
Species Human (GRCh38)
Location 7:155374902-155374924
Sequence GTTTGCGTCCTCGCCGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034963205_1034963210 -1 Left 1034963205 7:155374880-155374902 CCACGGAAGCCCCCTCAATGGTG No data
Right 1034963210 7:155374902-155374924 GTTTGCGTCCTCGCCGCCACCGG No data
1034963202_1034963210 7 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963210 7:155374902-155374924 GTTTGCGTCCTCGCCGCCACCGG No data
1034963204_1034963210 0 Left 1034963204 7:155374879-155374901 CCCACGGAAGCCCCCTCAATGGT No data
Right 1034963210 7:155374902-155374924 GTTTGCGTCCTCGCCGCCACCGG No data
1034963206_1034963210 -10 Left 1034963206 7:155374889-155374911 CCCCCTCAATGGTGTTTGCGTCC No data
Right 1034963210 7:155374902-155374924 GTTTGCGTCCTCGCCGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034963210 Original CRISPR GTTTGCGTCCTCGCCGCCAC CGG Intergenic
No off target data available for this crispr