ID: 1034963211

View in Genome Browser
Species Human (GRCh38)
Location 7:155374907-155374929
Sequence CGTCCTCGCCGCCACCGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034963209_1034963211 -8 Left 1034963209 7:155374892-155374914 CCTCAATGGTGTTTGCGTCCTCG No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data
1034963207_1034963211 -6 Left 1034963207 7:155374890-155374912 CCCCTCAATGGTGTTTGCGTCCT No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data
1034963204_1034963211 5 Left 1034963204 7:155374879-155374901 CCCACGGAAGCCCCCTCAATGGT No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data
1034963206_1034963211 -5 Left 1034963206 7:155374889-155374911 CCCCCTCAATGGTGTTTGCGTCC No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data
1034963205_1034963211 4 Left 1034963205 7:155374880-155374902 CCACGGAAGCCCCCTCAATGGTG No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data
1034963202_1034963211 12 Left 1034963202 7:155374872-155374894 CCGCGGACCCACGGAAGCCCCCT No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data
1034963208_1034963211 -7 Left 1034963208 7:155374891-155374913 CCCTCAATGGTGTTTGCGTCCTC No data
Right 1034963211 7:155374907-155374929 CGTCCTCGCCGCCACCGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034963211 Original CRISPR CGTCCTCGCCGCCACCGGCT TGG Intergenic
No off target data available for this crispr