ID: 1034964663

View in Genome Browser
Species Human (GRCh38)
Location 7:155383794-155383816
Sequence GCTGCTAGTGCTGCCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034964653_1034964663 12 Left 1034964653 7:155383759-155383781 CCCATCCATCCGAGCCTGCAAAT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1034964663 7:155383794-155383816 GCTGCTAGTGCTGCCTGTGCAGG No data
1034964655_1034964663 7 Left 1034964655 7:155383764-155383786 CCATCCGAGCCTGCAAATTACTC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1034964663 7:155383794-155383816 GCTGCTAGTGCTGCCTGTGCAGG No data
1034964654_1034964663 11 Left 1034964654 7:155383760-155383782 CCATCCATCCGAGCCTGCAAATT 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1034964663 7:155383794-155383816 GCTGCTAGTGCTGCCTGTGCAGG No data
1034964656_1034964663 3 Left 1034964656 7:155383768-155383790 CCGAGCCTGCAAATTACTCACGG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1034964663 7:155383794-155383816 GCTGCTAGTGCTGCCTGTGCAGG No data
1034964662_1034964663 -2 Left 1034964662 7:155383773-155383795 CCTGCAAATTACTCACGGGGGGC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1034964663 7:155383794-155383816 GCTGCTAGTGCTGCCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034964663 Original CRISPR GCTGCTAGTGCTGCCTGTGC AGG Intronic
No off target data available for this crispr