ID: 1034964719

View in Genome Browser
Species Human (GRCh38)
Location 7:155384032-155384054
Sequence CCCCCAGAGAAGGCGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034964719_1034964729 -10 Left 1034964719 7:155384032-155384054 CCCACGCCCGCCTTCTCTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1034964729 7:155384045-155384067 TCTCTGGGGGGTGTCTCTGGGGG 0: 1
1: 0
2: 3
3: 25
4: 225
1034964719_1034964730 -9 Left 1034964719 7:155384032-155384054 CCCACGCCCGCCTTCTCTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1034964730 7:155384046-155384068 CTCTGGGGGGTGTCTCTGGGGGG 0: 1
1: 0
2: 7
3: 31
4: 283
1034964719_1034964733 11 Left 1034964719 7:155384032-155384054 CCCACGCCCGCCTTCTCTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1034964733 7:155384066-155384088 GGGTGTCTGGTCTGCGGAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 153
1034964719_1034964732 5 Left 1034964719 7:155384032-155384054 CCCACGCCCGCCTTCTCTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1034964732 7:155384060-155384082 TCTGGGGGGTGTCTGGTCTGCGG No data
1034964719_1034964731 -2 Left 1034964719 7:155384032-155384054 CCCACGCCCGCCTTCTCTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1034964731 7:155384053-155384075 GGGTGTCTCTGGGGGGTGTCTGG 0: 1
1: 0
2: 2
3: 29
4: 348
1034964719_1034964734 12 Left 1034964719 7:155384032-155384054 CCCACGCCCGCCTTCTCTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1034964734 7:155384067-155384089 GGTGTCTGGTCTGCGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034964719 Original CRISPR CCCCCAGAGAAGGCGGGCGT GGG (reversed) Intronic
900944383 1:5821623-5821645 CCCACAGAGTAGGCAGGCTTAGG - Intergenic
903986632 1:27234085-27234107 CCCCCAGAGCAGGAAGGAGTGGG + Intergenic
904170967 1:28592131-28592153 CCCACAGAGGAGGCGGGGGGTGG + Intronic
904374009 1:30068482-30068504 CCCCCAGAGAGGGCAGGCGATGG + Intergenic
904375676 1:30080785-30080807 CCTCCAGAGAAGGAGGCCGTGGG - Intergenic
904926503 1:34053132-34053154 CCCCAAGAGAAGGCGTGGGAAGG - Intronic
905173428 1:36122553-36122575 TCCCCAGAGAAGGCAGGTGCAGG - Intronic
906507986 1:46394228-46394250 CCTCCCGCGCAGGCGGGCGTGGG + Intergenic
906960935 1:50419173-50419195 CCCCCAGATAAGGCCGCCGTGGG - Exonic
915544128 1:156586332-156586354 GCTCCAGAGAAGGAGGGAGTTGG - Intronic
919732380 1:200921565-200921587 CCTCCAGGGAAGGAGGGCCTGGG - Intergenic
919834693 1:201565735-201565757 CCCCCAGAGAGGCAGGGGGTGGG - Intergenic
920097150 1:203493788-203493810 TCCTCAGAGAAGGCTGGAGTCGG - Intergenic
923149244 1:231219004-231219026 CCCCCTGGGAAGGCGGGTTTCGG + Intronic
1062834089 10:624635-624657 CCCACGGAGGAGGCGAGCGTCGG + Intronic
1062979803 10:1712645-1712667 CCCCCAGGGAAGGAGGGCACTGG + Intronic
1067084467 10:43230497-43230519 CCCCCAGAGAGGGCGCTCTTCGG - Intronic
1067278590 10:44854892-44854914 CACCCAGAAAAGGCGGGAGAGGG + Intergenic
1069872506 10:71541628-71541650 CCCCCAGAGCAGCCAGGAGTGGG - Intronic
1072413783 10:95230514-95230536 AATCCAGAGAAGGCGGGGGTCGG - Intergenic
1073099201 10:100998187-100998209 CCCCCAGGGAATGAGGGAGTGGG + Intronic
1073251093 10:102120694-102120716 ACCCCAGAGAGGGAGGGCGAAGG + Intergenic
1074085883 10:110208749-110208771 CCCCCAAAGAAGGAGGCCGGCGG + Intronic
1074186797 10:111105057-111105079 GCTCCCGAGAAGGCGTGCGTCGG + Intergenic
1074980917 10:118619496-118619518 CGCCCAGAGAAGGCAGGCTGGGG + Intergenic
1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG + Intronic
1078164554 11:8871035-8871057 CCTGCAGAGAGGGCGGGCGGCGG + Intronic
1083632055 11:64100845-64100867 GCCCCAGGGAAGGTGGGGGTGGG + Intronic
1088676595 11:112199725-112199747 CCTCCAGAGAAGGTGGACCTTGG + Exonic
1090645792 11:128765572-128765594 CCCCCAGAGCAAGAGGGCATAGG - Intronic
1093711525 12:22334490-22334512 CCCCTGCAGAAGGCGGGCGCTGG + Exonic
1094835812 12:34321533-34321555 GCCGCAGAAAAGGGGGGCGTGGG - Intergenic
1097949286 12:65408759-65408781 CCAACAGAGAAGGCTGGAGTGGG + Intronic
1103327799 12:120133081-120133103 CCCACAGAGAAGGCTGGGGCTGG + Intronic
1103691053 12:122774634-122774656 CCCCCGGAGAAGCCCGGTGTGGG - Exonic
1103789339 12:123458409-123458431 CCCCCAGAGAAGGAGAGGGGCGG + Intronic
1104669019 12:130667717-130667739 CCCCCAGGGAGGGCGGGGGCTGG + Intronic
1104842986 12:131833519-131833541 CCCCCAGAGGAGGCCGGTGCAGG + Intronic
1117458343 14:55920055-55920077 CCCCTAGACATGGCGGCCGTCGG + Intergenic
1119194581 14:72708122-72708144 AGCCCAGAGAAGGCAGGTGTAGG + Intronic
1129192290 15:73944521-73944543 GCCTCAGAGGAGGTGGGCGTGGG + Intronic
1130893265 15:88151033-88151055 CCCACAGAAAAGGCTGCCGTGGG - Intronic
1132651543 16:1023420-1023442 CCTCCAGAGAAGTCGGGGTTGGG + Intergenic
1132737532 16:1394326-1394348 ACCCCTGAAAAGGGGGGCGTGGG + Intronic
1132804511 16:1769349-1769371 GCCCCAGAGAAGGCCGGCTGGGG - Exonic
1132900421 16:2251281-2251303 CGCCGAGGGAGGGCGGGCGTGGG - Intronic
1133075200 16:3274812-3274834 CCCTCAGAAAAGGTGGGCATTGG + Intronic
1136387835 16:29941083-29941105 CCCCCAGAGAAGGCAGGAGTGGG + Intronic
1142858798 17:2749059-2749081 CTCCCAGGGAAGGCAGGGGTTGG + Intergenic
1144626103 17:16845197-16845219 CCCCCAGAAAAGGGGGATGTGGG + Intergenic
1144880330 17:18427523-18427545 CCCCCAGAAAAGGGGGATGTGGG - Intergenic
1145151905 17:20516864-20516886 CCCCCAGAAAAGGGGGATGTGGG + Intergenic
1147456692 17:40542440-40542462 GCCCCAGGGAGGGCGGGCGATGG - Intergenic
1147667097 17:42155602-42155624 CCCCGAGGGAAGGCGGGTGGTGG + Intergenic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1151657642 17:75503160-75503182 CCCTCAGCGAAGGCGGGCGCCGG - Exonic
1151682184 17:75628085-75628107 GCCCCAGGGAGGACGGGCGTGGG + Intronic
1152345316 17:79747639-79747661 GCACCTCAGAAGGCGGGCGTGGG - Intergenic
1152585949 17:81189522-81189544 CCCCCAGAGCAGCCAGGCGTGGG - Intergenic
1152594709 17:81232561-81232583 CTCCCAGAGAACGCGGGTGGGGG - Intronic
1152915163 17:83030841-83030863 TCCCCAGTGAAGACGGGAGTCGG + Intronic
1154157568 18:11955919-11955941 GCCCCAGAGAAGGGGGGCCGTGG + Intergenic
1154445321 18:14431145-14431167 CCCCCAGAGGAGACGGGGGACGG + Intergenic
1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG + Exonic
1158960533 18:62584307-62584329 CCTGCAGAGAATGCGGGCCTTGG + Intronic
1160937659 19:1604885-1604907 CCCCCATAGAAGCCGGGCTGGGG - Intronic
1160980359 19:1813876-1813898 CCCCCTGCGAAGGCTGGGGTGGG - Intergenic
1161175962 19:2842100-2842122 CCCCCAGAGACCGCGGCCGGAGG - Intronic
1163111132 19:15161410-15161432 CCCCCCGGGAAGGCGGGGCTGGG - Exonic
1167469732 19:49668953-49668975 GCCCCAGAGAAGGATGGCGGTGG + Intronic
932820487 2:74895542-74895564 CCCACAGAGCAGGTGGGAGTTGG - Intergenic
936025146 2:109025992-109026014 CCCCCAGGGAGGGCAGGCCTTGG - Intergenic
942149078 2:173056922-173056944 CCCCCAGAGAATAAGGGCGTGGG + Intergenic
946249948 2:218405816-218405838 CCCCCAGAGCGGGTGGGCGGGGG + Exonic
946310387 2:218879908-218879930 CCCCCAGAAAATGCTTGCGTAGG - Intergenic
948920280 2:241063136-241063158 GGCGCAGAGAAGGTGGGCGTCGG + Intronic
1169092814 20:2872068-2872090 CCCCAACAGAAGGCGGTGGTGGG + Intronic
1169092842 20:2872179-2872201 CCCCAACAGAAGGCGGTGGTGGG + Intronic
1172275086 20:33674854-33674876 GTGCCAGAGAGGGCGGGCGTCGG - Intergenic
1176190795 20:63808621-63808643 CCCCCAGAGAAGGCCCTCCTCGG + Intronic
1179541544 21:42086135-42086157 CCCCCAGGGAGGGCGGCCTTGGG - Intronic
1183485593 22:38086214-38086236 CCCCAAGAGAGGGCGGGCAAGGG + Intronic
1185019056 22:48362947-48362969 ACCCCAGGGAAGGCAGGAGTAGG + Intergenic
951140218 3:19149048-19149070 CCCACAGTGAATACGGGCGTCGG - Intronic
954298998 3:49689371-49689393 TCCCCAGAGCAGGCGGAGGTCGG + Intronic
954489178 3:50885614-50885636 CCACCAGAGAAGGCTGACGGAGG + Intronic
956701637 3:71964350-71964372 CCCCATGAGAAGGCAGGTGTTGG - Intergenic
956727956 3:72172042-72172064 CTCCCAGAGGAGGCAGGGGTAGG + Intergenic
962422222 3:135238822-135238844 CCCCCAGAAAAGAGGGGCTTTGG - Intronic
963227623 3:142878251-142878273 CCCACAGAGAAGTGGGGAGTTGG - Intronic
965670206 3:171140332-171140354 ACCCCAGAGAAGGCTGGTGCTGG + Intronic
967977049 3:195041302-195041324 CCTCCAGAGAATGGGGGCGGGGG - Intergenic
968600587 4:1507172-1507194 AGCCCAGAGAAGGCACGCGTGGG - Intergenic
968885570 4:3329323-3329345 GCCCCATAGAAGGTGGGAGTGGG + Intronic
969596485 4:8151990-8152012 CCCCCATAGGAGGCGGGTTTGGG + Intronic
982240668 4:153296419-153296441 CTCCCAGGGAAGAGGGGCGTTGG - Intronic
982380503 4:154743452-154743474 CACCCAGAGCAGGAGGGCGGTGG - Intronic
984260870 4:177442465-177442487 ACCCCCGAGAGAGCGGGCGTGGG - Exonic
984515834 4:180737883-180737905 CACCTATAGAAGGCGGGGGTGGG - Intergenic
985628399 5:1002059-1002081 TCCCCAGACAAGGCCTGCGTGGG + Intergenic
992591060 5:78295751-78295773 CCACCTGAGAAGGCGGGCTGGGG - Intergenic
992979894 5:82158351-82158373 CCCACAGAGATGGGGGGCGGGGG - Intronic
999079076 5:148826463-148826485 CCCCAGGAGAAGGAGGGCGAGGG + Exonic
1002558311 5:180061633-180061655 CACACAGAGAAGGCGGCCATAGG - Intronic
1004537616 6:16518221-16518243 CCCCCATAGAAAGCTGGGGTGGG - Intronic
1005583052 6:27251457-27251479 TCCCCAGAGAGGGCGGGGTTTGG + Intronic
1006794154 6:36721561-36721583 ACCCCAGAGGAGGCGGCCCTCGG - Exonic
1011741432 6:90364474-90364496 CCCCCAGAGAAGCCGGTCACAGG - Intergenic
1017103261 6:150866265-150866287 CCCGCAGCGCAGGTGGGCGTGGG + Intronic
1018207540 6:161449698-161449720 CCACCAGAGATGGTGGGTGTTGG + Intronic
1027227180 7:76251149-76251171 GCCCCACAGAGGACGGGCGTCGG - Intronic
1029713757 7:102314529-102314551 CCCCCAGAGACGACAGCCGTGGG + Exonic
1032479284 7:132233634-132233656 CCCCTACAGAAGGAGGGCATAGG + Intronic
1033601668 7:142893149-142893171 CCCTCTGACAAGGCGGGAGTGGG + Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034964719 7:155384032-155384054 CCCCCAGAGAAGGCGGGCGTGGG - Intronic
1035212091 7:157336474-157336496 CGGCCAGCGAAGGCGGGCGAAGG - Intronic
1035581103 8:739254-739276 CCCCCGGAGAGGTCGGGCCTGGG + Intergenic
1039386184 8:37137818-37137840 CCCCCTGAGCAGGCAGGGGTGGG - Intergenic
1039902861 8:41765932-41765954 CCCCCAGAGAAGGTGTGAGGAGG - Intronic
1042485518 8:69341975-69341997 CCCCCAGAGCTGCCGGGTGTGGG + Intergenic
1049197970 8:141325806-141325828 CAGCCACAGAAGGCGGGGGTGGG + Intergenic
1049438413 8:142598227-142598249 ACCCCAGAGGAGGAGGGCGGGGG - Intergenic
1049542791 8:143215996-143216018 CCCCCAGGAAAGACGGGCCTGGG + Intergenic
1049742510 8:144247859-144247881 GCCCCAGCGTAGGCGGGTGTGGG - Intronic
1053073363 9:35114248-35114270 CTCTCAGAGAGGGCGGGCCTAGG - Intronic
1056942215 9:90965302-90965324 CCACGAGAGAAAGCGGGCGGAGG - Intergenic
1061207389 9:129172929-129172951 CCTCCAGAGAAGCCAGGGGTGGG - Intergenic
1062022300 9:134325453-134325475 CCGCCCGAGACGGCGGGCGGCGG + Intronic
1187825814 X:23333327-23333349 TTCCCCGAGAAGGCGGGCGCCGG - Intergenic
1199996766 X:153030785-153030807 CCCCCAGAGACGGCAGGGTTTGG - Intergenic
1200149802 X:153945804-153945826 GGCCCAGAGAAGGGGGGTGTGGG - Intergenic