ID: 1034964858

View in Genome Browser
Species Human (GRCh38)
Location 7:155384626-155384648
Sequence CCTGGATTCTGGTTCAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034964858_1034964870 15 Left 1034964858 7:155384626-155384648 CCCGCCCTGAACCAGAATCCAGG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1034964870 7:155384664-155384686 AGCACAGCAGCACCAACGACGGG No data
1034964858_1034964871 22 Left 1034964858 7:155384626-155384648 CCCGCCCTGAACCAGAATCCAGG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1034964871 7:155384671-155384693 CAGCACCAACGACGGGCGCATGG 0: 1
1: 0
2: 0
3: 2
4: 42
1034964858_1034964873 24 Left 1034964858 7:155384626-155384648 CCCGCCCTGAACCAGAATCCAGG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1034964873 7:155384673-155384695 GCACCAACGACGGGCGCATGGGG No data
1034964858_1034964869 14 Left 1034964858 7:155384626-155384648 CCCGCCCTGAACCAGAATCCAGG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1034964869 7:155384663-155384685 CAGCACAGCAGCACCAACGACGG 0: 1
1: 0
2: 1
3: 19
4: 171
1034964858_1034964872 23 Left 1034964858 7:155384626-155384648 CCCGCCCTGAACCAGAATCCAGG 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1034964872 7:155384672-155384694 AGCACCAACGACGGGCGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034964858 Original CRISPR CCTGGATTCTGGTTCAGGGC GGG (reversed) Intronic
900231743 1:1562522-1562544 CCAGGAGTCTGGTTTAGGGCTGG - Intronic
900231758 1:1562599-1562621 CCAAGAGTCTGGTTTAGGGCTGG - Intronic
900392316 1:2439028-2439050 CCTGGGAGCTGGGTCAGGGCTGG - Intronic
900513685 1:3071561-3071583 CCTGCCTTCTTGCTCAGGGCAGG - Intronic
900687853 1:3959975-3959997 CCTGGATTCTAGCACAGGGCTGG + Intergenic
901175130 1:7293348-7293370 CCTGGACACTGTTTCAGGGCTGG + Intronic
902329430 1:15724063-15724085 CCTGGTTACTGGAACAGGGCAGG - Intronic
902337827 1:15764057-15764079 CCTGGGTCCTGGTTCAGGCCTGG - Intronic
902777148 1:18682341-18682363 CCTAGGTTCTGGTTAGGGGCCGG + Intronic
903598488 1:24515769-24515791 CCTTGATTCTGCTGCAGGGCTGG - Intronic
904110939 1:28125574-28125596 CCAGGAATCTGGTTGATGGCAGG - Intergenic
905735648 1:40324062-40324084 CTTGGATGCTGGGTCAGGGGAGG - Intergenic
905822510 1:41004557-41004579 ACTGGACCCTGGTTCAGGCCAGG + Intronic
906088458 1:43156775-43156797 CCTGGCTTCTGGTGTAGGGGTGG - Intergenic
906647789 1:47488415-47488437 CTTGGACTCAGGTTTAGGGCAGG - Intergenic
906698047 1:47837990-47838012 ATGGGATTCTGGTTAAGGGCTGG - Intronic
907276233 1:53318010-53318032 CCTGGAGCTGGGTTCAGGGCTGG - Intronic
907399721 1:54217423-54217445 CCAGGATACTGACTCAGGGCTGG + Intronic
908351236 1:63287347-63287369 CCTGGATTCTGGGTCTGTGGGGG - Intergenic
908470147 1:64436359-64436381 CCTGGCTTCTGCTGGAGGGCTGG - Intergenic
912048261 1:105489152-105489174 TCTGGATTCTGGTTCAAATCAGG - Intergenic
912435445 1:109657884-109657906 CCTGGCTTCTGGTCCAGACCAGG - Intronic
919767604 1:201137219-201137241 CCTGGGTTCTGTTCCTGGGCTGG + Intronic
922480426 1:225936895-225936917 CCTGGATTCTGGTTCTGACAGGG - Exonic
922784283 1:228275480-228275502 CCTGGCGTCTTGTTCAGAGCAGG + Intronic
1063361973 10:5466677-5466699 CCTGGAAACTGCTGCAGGGCTGG + Intergenic
1063455169 10:6178014-6178036 GGTGGATGCTGGTTCAGGGCTGG + Intronic
1064365277 10:14701844-14701866 CCTGGAACCTGGAGCAGGGCTGG + Intronic
1067216335 10:44307367-44307389 TCTGTATTGTGGTTCTGGGCTGG + Intergenic
1070659378 10:78293702-78293724 CCTGGCTTCTGGGTGGGGGCTGG + Intergenic
1070716259 10:78724241-78724263 CCTGGCGTCTGCTTCTGGGCAGG + Intergenic
1073082120 10:100866963-100866985 AGGGGATTCTGGTGCAGGGCGGG - Intergenic
1073267739 10:102238352-102238374 CCAGGACTCAGGTTCAGGACGGG - Intronic
1074984001 10:118641535-118641557 CCTGTCTTCTGATTCAGGGATGG - Intergenic
1075852880 10:125603304-125603326 CCAGGTTTCTGGTGCAGGGATGG - Intronic
1076258114 10:129044886-129044908 CCTGGACCCTGGTTCTGAGCAGG - Intergenic
1077890562 11:6415194-6415216 ACTGGGTTCTGGCTCAAGGCAGG + Intronic
1079138982 11:17795166-17795188 TCTGGATTCTGGTACATGTCAGG + Intronic
1081676779 11:44974571-44974593 CCTGGAGTCTGGCTCAGCCCTGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1084216298 11:67648637-67648659 CCTGGCATCTGGAGCAGGGCTGG - Intronic
1086002057 11:81996140-81996162 CCTGGACGCTGCTGCAGGGCCGG - Intergenic
1086902037 11:92378813-92378835 CCTGCTTTCTGGTTCATGGATGG + Intronic
1087175825 11:95093940-95093962 ACTGGATTCTGGTTTAGTGCAGG + Intronic
1088514663 11:110617696-110617718 CCTGGATTCAGGTATAGAGCAGG - Intronic
1088745583 11:112801464-112801486 ACTGCCTTCTGCTTCAGGGCTGG + Intergenic
1089327570 11:117667691-117667713 GTTGGATTCTGTTTCAGGTCAGG - Intronic
1092296367 12:7202282-7202304 CCTGGAGTCCGGTGCAGGGTCGG + Exonic
1094209213 12:27873069-27873091 CCTAGAGTCTTGTACAGGGCTGG + Intergenic
1094302092 12:28976010-28976032 CCTGTATTATCCTTCAGGGCTGG - Intergenic
1096153727 12:49330584-49330606 CCTGGGTTCTGCTGGAGGGCAGG - Exonic
1098448541 12:70592808-70592830 CCTGGATTCTGGTTCAGACTGGG + Intronic
1098641441 12:72842778-72842800 CCTGGTTTCTGGTTCAGTCTAGG - Intergenic
1102004619 12:109581321-109581343 CCTGGCCCCTGGTTCAGTGCTGG + Intronic
1102298781 12:111756655-111756677 CCTGGAGTCTGTTTCAGGCCAGG + Exonic
1102979760 12:117232075-117232097 CCTGGAAGATGGTGCAGGGCGGG + Exonic
1103590524 12:121989249-121989271 CCTGGGCTCTGATGCAGGGCAGG + Intronic
1104136493 12:125944611-125944633 TCTGGACTGTGGTGCAGGGCGGG + Intergenic
1104563430 12:129859152-129859174 CCTGGTTTCTGGTTCGGAGATGG - Intronic
1105291254 13:19055179-19055201 GTTGGATCCTGGCTCAGGGCAGG + Intergenic
1105639776 13:22250234-22250256 CCTAGATGCTGTTGCAGGGCTGG + Intergenic
1115518699 14:34211537-34211559 CTTAGATTCTTGTTCAGGGGAGG - Intronic
1118978989 14:70701092-70701114 CCTGGTGCCTGCTTCAGGGCTGG - Intergenic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119287166 14:73464847-73464869 TCTGGATTCTGGTTGGGGCCAGG - Intergenic
1119410592 14:74427558-74427580 CCTGGGGTCTGTCTCAGGGCTGG + Intergenic
1122845675 14:104496828-104496850 CCTGGAGTATGGAGCAGGGCAGG - Intronic
1125395942 15:39248126-39248148 GTTGGATTCAGGTTCAGGGTTGG + Intergenic
1125547130 15:40513986-40514008 TCTGGATTCTGGATGAGAGCAGG + Intergenic
1126646189 15:50877037-50877059 GGTGGATTCTGGTTCTGGGACGG + Intergenic
1127959494 15:63880231-63880253 CCTGGAGCCTGGTTGGGGGCTGG - Intergenic
1128357407 15:66937734-66937756 CCTGCTTTCTGGTTCAGAGATGG - Intergenic
1129734351 15:77951539-77951561 CCTGGGATCTGGTGCTGGGCTGG - Intergenic
1129841235 15:78744452-78744474 CCTGGGATCTGGTGCTGGGCTGG + Intergenic
1132852959 16:2033069-2033091 CCTGGGTCCTGGGGCAGGGCAGG + Intronic
1134211893 16:12284506-12284528 CCCTGGTTTTGGTTCAGGGCTGG + Intronic
1136229103 16:28876625-28876647 GCAGGATTCTGCTTCAGGGGAGG + Intergenic
1137870096 16:51941697-51941719 TCTGGATTCTGGTTAAAGGGAGG - Intergenic
1138224045 16:55277416-55277438 CCTGGATTCAGATTCAGGTTTGG - Intergenic
1139890541 16:70251069-70251091 TCAGGCTTCTGGTTCAGGGCTGG + Exonic
1143013989 17:3882048-3882070 CCTTGTGTCTGGTTCAGGGCTGG - Intronic
1143028857 17:3956236-3956258 ACTGGATCCTGGGTCAGGGTGGG - Intronic
1143517537 17:7427272-7427294 CCTGGACTTTGGGCCAGGGCTGG - Exonic
1143774500 17:9189061-9189083 AATGGATTCTGGCTCAGGGAAGG + Intronic
1144766993 17:17738351-17738373 CCCAGTTCCTGGTTCAGGGCTGG + Intronic
1146480051 17:33197761-33197783 CCTGGGTACTGGTTCTGGTCTGG + Intronic
1147176703 17:38660274-38660296 CCTAGTTTCTGTTTCAAGGCAGG + Intergenic
1147557513 17:41488843-41488865 CCTGGGGTGTGGCTCAGGGCTGG - Intronic
1147870347 17:43582689-43582711 CCCAGCTCCTGGTTCAGGGCAGG - Intergenic
1148440712 17:47710412-47710434 CCTGGGTCCTGGGACAGGGCAGG + Intronic
1148733139 17:49850107-49850129 CCTGGATTCAGGGTGAGTGCAGG - Intergenic
1149102900 17:52927770-52927792 CCTGGATGCTGCCACAGGGCTGG - Intergenic
1152498293 17:80690646-80690668 CCTAGATTCTGGTTCAGTCAGGG + Intronic
1153493820 18:5677138-5677160 CCTTGATTCTAGGTGAGGGCAGG + Intergenic
1157128003 18:44975921-44975943 CCTGTATTCTGGTCCAGGCTTGG - Intronic
1157234830 18:45954594-45954616 CTTGGAGCCTGGTTCATGGCTGG - Exonic
1157545528 18:48543841-48543863 CCTGTCTTCTGGTTCTGGGAAGG + Intronic
1157596959 18:48869882-48869904 CCAGGGTTCTGGGGCAGGGCTGG - Intergenic
1158629012 18:59095990-59096012 CCTGGCTTCTGGTGCTTGGCTGG - Intergenic
1161222446 19:3123899-3123921 TCTGGATTAAGGGTCAGGGCCGG - Exonic
1161310328 19:3590243-3590265 GCTGGGTTCTGGAGCAGGGCCGG - Exonic
1161684912 19:5697902-5697924 CTTGGAGCCTGGTTCAGGGATGG - Intronic
1162156233 19:8679668-8679690 CTTTGGTTCTGGTCCAGGGCAGG + Intergenic
1162189946 19:8937043-8937065 GCTGGATTCTGCCTCAGGACTGG + Exonic
1164782086 19:30901028-30901050 CCTGGAATCTGCTCCAGGCCGGG + Intergenic
1165095568 19:33407998-33408020 CCTGGTTCCTGCTTCAGGTCAGG - Intronic
1165502656 19:36202497-36202519 CCTGGGTTCTGTGTCAGTGCTGG - Intronic
1166895355 19:46019009-46019031 CCGGGGTCTTGGTTCAGGGCCGG + Intronic
1167715854 19:51142553-51142575 CATGGCTACTGGTTCCGGGCAGG + Exonic
1167718977 19:51164844-51164866 CCGGAATTCTGGTGCATGGCTGG + Intergenic
1167762463 19:51458179-51458201 CATGGCTACTGGTTCCGGGCAGG - Exonic
1167768889 19:51501534-51501556 CATGGCTACTGGTTCCGGGCAGG - Exonic
1168171213 19:54590994-54591016 TCAGGAGTTTGGTTCAGGGCAGG - Intronic
925826105 2:7849863-7849885 CCTGGTTTCTGTTTCATGCCTGG - Intergenic
925834340 2:7929436-7929458 CGTGGAGTCTGGGTTAGGGCTGG - Intergenic
926599220 2:14823968-14823990 CGGTGATTCAGGTTCAGGGCAGG - Intergenic
929920242 2:46166442-46166464 CCAGGACTCTGATCCAGGGCTGG + Intronic
931235490 2:60409371-60409393 CCTGGAAGCCGGTTTAGGGCAGG + Intergenic
931262405 2:60631696-60631718 CGTGAATTCTTGTGCAGGGCAGG + Intergenic
934525263 2:95048005-95048027 CCTGGCCCCTGGTCCAGGGCTGG + Exonic
941528681 2:166637678-166637700 CTTGGATTCTCATTCAGGGTAGG - Intergenic
941674391 2:168328433-168328455 CCTGGCTCCTGGGTCAGGGTGGG + Intergenic
941965460 2:171296150-171296172 TCTGGATACTGATTTAGGGCTGG + Intergenic
942328011 2:174791873-174791895 ACTGAATGCTGGTTCTGGGCTGG + Intergenic
944507205 2:200424963-200424985 CCTGCTTTGTGGTACAGGGCAGG - Intronic
946332263 2:219017146-219017168 CCTAGATGCTGGCTCTGGGCTGG - Intronic
948447446 2:238043781-238043803 CCTGAATCCTGGTTCTTGGCTGG + Intronic
1170498224 20:16947750-16947772 CCTAGAATCTGAATCAGGGCCGG - Intergenic
1170519388 20:17168359-17168381 CCTGGATGCTGGGTGAGGGGAGG - Intergenic
1171334484 20:24371066-24371088 CATGGATTCTGGTTCAATGTTGG + Intergenic
1172869356 20:38126286-38126308 CCTGGACTCCGGATCAGAGCTGG - Intronic
1174202979 20:48820049-48820071 CCTTGATTCTGGGCCAGGGGAGG - Intronic
1174743291 20:53037771-53037793 CCTGGGTGCTGGGGCAGGGCCGG + Intronic
1175583624 20:60120106-60120128 GCTGGACTCTGGTTCAGAGCCGG - Intergenic
1178735468 21:35145571-35145593 CCTGGATTCTGCTGGAGGGATGG - Intronic
1179431458 21:41323991-41324013 CCTGCATTCTGCTTCATGGATGG + Intronic
1180087541 21:45514686-45514708 CAGGGCTTCTGATTCAGGGCCGG - Exonic
1180858337 22:19062320-19062342 CCTGGCTGCTGGGACAGGGCAGG - Intronic
1180987138 22:19911707-19911729 CCTTGACCCTGGTTCAGAGCAGG + Intronic
1181588162 22:23865674-23865696 ACAGGATTCTTGTTGAGGGCAGG + Intronic
1181615817 22:24053714-24053736 CCTGGATGCTGGCTCTGTGCAGG + Intronic
1183292727 22:37012603-37012625 CCTGGATTATGGGACAGGGCAGG + Intronic
1183429877 22:37759103-37759125 CCTGGAAGCTGGGGCAGGGCTGG - Intronic
1185036398 22:48479391-48479413 CCTGGCTGCAGGCTCAGGGCAGG - Intergenic
1185296449 22:50057472-50057494 TCTGGATTGTGGGTCAGGTCTGG + Intergenic
1203293000 22_KI270736v1_random:13663-13685 CCTGGCTTCTGCTTCTGGGGAGG - Intergenic
950196225 3:11011077-11011099 CCTGCCATCTGGTCCAGGGCTGG + Intronic
950310578 3:11954328-11954350 CATGGAGTCTGGCACAGGGCAGG + Intergenic
951288049 3:20839482-20839504 CATGGATTCTAGCTCAGGCCAGG + Intergenic
951475387 3:23100292-23100314 ACTGGCTTCTGCTTCAGGGGAGG + Intergenic
952419009 3:33114583-33114605 CCTGGAGGCTGGGTCAGGGGCGG - Intronic
953352994 3:42230115-42230137 CCTGGAAAGTAGTTCAGGGCGGG + Intergenic
954379356 3:50211327-50211349 TCTGGACTTTGGTCCAGGGCAGG - Intronic
955842182 3:63124376-63124398 CCTGGGATCTGGCCCAGGGCAGG - Intergenic
955870457 3:63432951-63432973 CCTGGCTTCTGATTCAGGAGAGG + Intronic
961468477 3:127096473-127096495 CATGGGTTCTGATGCAGGGCAGG - Intergenic
961683916 3:128616932-128616954 CCTGGACCCTGGCTCAGGGAGGG - Intergenic
962123460 3:132589105-132589127 CCTGCATTCTGGTTCATAGATGG - Intronic
963123278 3:141794009-141794031 CCTGGACTCAGGTGCAGGGAGGG - Intronic
964301540 3:155291667-155291689 CATTGATTCAGGTTCAGTGCTGG - Intergenic
965317361 3:167208907-167208929 CCTCTCTTCTGGTCCAGGGCAGG - Intergenic
967090448 3:186130437-186130459 CCTTAATAATGGTTCAGGGCTGG + Intronic
967111673 3:186299022-186299044 CCTGGCTTCTGGTCCCAGGCTGG + Intronic
968972369 4:3802691-3802713 CCTGGACTCTGGGGCAGGGGAGG + Intergenic
969102980 4:4784110-4784132 CCTGGCTTCTGGTGCAGGCTTGG - Intergenic
969343949 4:6559749-6559771 CCTGCGTTCTGGTTCACGGATGG - Intronic
969690007 4:8699059-8699081 CCTGGGCTCTGATCCAGGGCTGG - Intergenic
970114348 4:12677048-12677070 CCTGGAAACTCATTCAGGGCAGG + Intergenic
971423418 4:26493853-26493875 ACTCCATTTTGGTTCAGGGCAGG - Intergenic
972360341 4:38320475-38320497 CCTGGCTTCTGGAACAGCGCAGG + Intergenic
973678258 4:53287522-53287544 CATTGACTCTGGTTCTGGGCGGG - Intronic
974326574 4:60422368-60422390 CCTGTTTTCTGGTTTAGGGGTGG - Intergenic
975409243 4:74029517-74029539 CCTGTATTCTGCTCCAGGGTGGG + Intergenic
975760239 4:77613114-77613136 CATGGATTCTGGTTCCGCACTGG - Intergenic
976383466 4:84427624-84427646 CATGGATTCTGGTACATGGAAGG - Intergenic
977332126 4:95650588-95650610 CCTTGATTCTGGTTTAGAACTGG - Intergenic
977575555 4:98670510-98670532 CCAAGACTCTGGTTTAGGGCAGG + Intergenic
979860324 4:125685583-125685605 CCTAGAACCTGGTGCAGGGCAGG - Intergenic
980712762 4:136591567-136591589 GCTCCTTTCTGGTTCAGGGCAGG - Intergenic
987141531 5:14951748-14951770 GCAGGATTCTGGTTGAAGGCAGG - Intergenic
988023945 5:25658965-25658987 CCTGTCTTCTGGTTGAGGGCTGG - Intergenic
988646882 5:33104857-33104879 ACTTGATTCTCGTTCAGTGCTGG - Intergenic
989019260 5:36981905-36981927 CCTGTATTGTGGTTGAGGGGTGG + Intronic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
999119432 5:149197911-149197933 CATGGAGTCTGATTCAGGCCCGG + Intronic
999591186 5:153148322-153148344 ACTGAATTCTCTTTCAGGGCTGG + Intergenic
1001130710 5:169061351-169061373 CCTGGGTTCTGGTCCAGGGAAGG - Intronic
1002441168 5:179265295-179265317 CATGGTTTCTGGTTCAGGGGTGG - Intronic
1003047590 6:2748190-2748212 AGTGAATTCTGGTTGAGGGCTGG - Intronic
1003292768 6:4794026-4794048 ACAGGATTATAGTTCAGGGCAGG + Intronic
1004039987 6:11965976-11965998 CTTGGATTCTGGTTTCTGGCTGG + Intergenic
1005812657 6:29529114-29529136 CCTGGATGTGGGGTCAGGGCAGG - Intergenic
1006062018 6:31430661-31430683 CCTGGCAACTGCTTCAGGGCAGG - Intergenic
1007298820 6:40850193-40850215 TCTGGATTCTTTTTCAGGGAAGG - Intergenic
1007930663 6:45687584-45687606 CCTGATTTCTGGTGCTGGGCAGG + Intergenic
1007998840 6:46337681-46337703 GCTTGATTTTGGTTCAGGGCTGG + Intronic
1008691812 6:53987618-53987640 GCTGGATTCTGCTTCAAGGATGG + Intronic
1011113453 6:83863902-83863924 CCTGGATTTTGGTATAGGGTAGG + Intronic
1014276272 6:119393993-119394015 CCAGGATGCTGCTGCAGGGCCGG - Intergenic
1015125329 6:129747925-129747947 CCTGGATTCTGGGTGAGAGCAGG + Intergenic
1016921940 6:149304210-149304232 CCCTGATTCAGGTTCAGGACTGG - Intronic
1017761750 6:157574608-157574630 CTTGGATTCTGGCTCAGGCAGGG - Intronic
1017874385 6:158512860-158512882 CTTGGATTCTGTTTCAGGATTGG - Intergenic
1019623060 7:2002006-2002028 CCTGGACCCTGGGTCTGGGCAGG - Intronic
1019634247 7:2067086-2067108 CCCCGATTCTGGGTCGGGGCTGG - Intronic
1020676083 7:11186479-11186501 CCTGCTTTCTGGTTCATGGATGG - Intergenic
1021042139 7:15875292-15875314 CCTGCATTCTGGTTCATAGATGG + Intergenic
1021597292 7:22330864-22330886 CCTGTATTCTGGGTCAGAGAGGG - Intronic
1022480624 7:30740999-30741021 CCTGGCTGCTGCCTCAGGGCCGG - Intronic
1023586668 7:41738142-41738164 CCTGGACACTGGTTCGGGGGCGG - Intergenic
1025149816 7:56539407-56539429 CCTGGGTTCTGGGTGAGGGGGGG + Intergenic
1026111779 7:67464186-67464208 CCTGGTTTCTGGTTCACAGATGG + Intergenic
1026812170 7:73477387-73477409 TCTGCATTCTGTTTCAGAGCTGG - Exonic
1028636440 7:92994521-92994543 CTTGGAATCTGGTTCTGGGTTGG + Intergenic
1028697432 7:93731323-93731345 GCTGGATTCTACATCAGGGCAGG - Intronic
1029591708 7:101511345-101511367 GCTGGACTCGGTTTCAGGGCTGG + Intronic
1032511422 7:132475537-132475559 TCTGGATTCTTGTTCTGTGCGGG - Intronic
1034100551 7:148446290-148446312 TCAGGCTTCTGGTTCAGGGTGGG - Intergenic
1034928450 7:155141680-155141702 CCTGCATCCTGGCTCAGGGAGGG - Intergenic
1034964858 7:155384626-155384648 CCTGGATTCTGGTTCAGGGCGGG - Intronic
1035179919 7:157081904-157081926 CCTGGAATCGGATTCAGGGAGGG - Intergenic
1035202864 7:157278238-157278260 CCTGGAGTCTCATTCAGGGAAGG + Intergenic
1035650171 8:1257858-1257880 CCTTGACACTAGTTCAGGGCTGG + Intergenic
1036026174 8:4911560-4911582 CCTGGATGCAGGTAGAGGGCAGG - Intronic
1036688755 8:10928201-10928223 CCTGGATTCTGGTCCCGTCCGGG - Intronic
1047404163 8:124571182-124571204 CCTGGAATCTGCCTCAGGGCAGG + Intronic
1048140178 8:131786602-131786624 CCTGGCTTCTGGGTCAGGTGGGG + Intergenic
1048969123 8:139634551-139634573 CCTGGATTCTCCATGAGGGCAGG + Intronic
1049079222 8:140428702-140428724 ACTGAATTCTGTTTCAGGGAAGG - Intronic
1049436874 8:142590473-142590495 CATGGTTCCTGGTTCTGGGCAGG + Intergenic
1049476868 8:142800989-142801011 CCTGGGGTCTGGACCAGGGCAGG + Intergenic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1053164323 9:35833849-35833871 CCTGTATACTGGCTCAGGGCAGG - Intronic
1057270369 9:93646982-93647004 GCTGGATCCCGGCTCAGGGCAGG - Intronic
1057407513 9:94786753-94786775 CCTGGATCCTGGTTGAATGCTGG - Intronic
1059348630 9:113649117-113649139 CCTGGCTGCTGGTGCAGGGCCGG + Intergenic
1060589542 9:124808177-124808199 GCTGCATTCTGGTTCCTGGCAGG - Intronic
1060948657 9:127586602-127586624 CCTGAATCCTGGAGCAGGGCTGG - Intergenic
1061114474 9:128600625-128600647 CCTGTATTCTTGGTCAGGGATGG - Intronic
1062222214 9:135422818-135422840 CCTGGGTCCTGGCTCTGGGCTGG - Intergenic
1185459452 X:328143-328165 CCAGGACCCTGGGTCAGGGCGGG - Intergenic
1186273892 X:7919514-7919536 TCTGGATTCTGTGTCATGGCTGG - Intronic
1186795638 X:13044402-13044424 CCTGGGGCCTGGGTCAGGGCAGG - Intronic
1187089827 X:16084318-16084340 CCTGGACTCTCATTCATGGCTGG - Intergenic
1187176263 X:16898627-16898649 CCTGGATCCTGGATCAGCGGGGG + Intergenic
1190530401 X:51368899-51368921 GCTACATTCTGGCTCAGGGCAGG - Intergenic
1193775403 X:85635271-85635293 ACTGGATTCTGCCTCAGTGCTGG + Intergenic
1194080551 X:89458632-89458654 CCAGGCTTCTGGATAAGGGCAGG + Intergenic
1196385110 X:115140598-115140620 CCTGAATTCTGGCTTGGGGCAGG - Intronic
1196566387 X:117210191-117210213 CCTGGATTCTGGTTCTACACGGG - Intergenic
1198434284 X:136600146-136600168 ACTCGATTCTAGTTCAGGGAGGG - Intergenic
1199851379 X:151726775-151726797 GCTGGCTTCTGGATCTGGGCAGG + Intergenic
1200293133 X:154890280-154890302 CCTGGGTTCTAATTCAGGGGTGG - Intronic
1200339980 X:155386012-155386034 CCTGGGTTCTAATTCAGGGGTGG - Intergenic
1200346490 X:155454676-155454698 CCTGGGTTCTAATTCAGGGGTGG + Intergenic
1200433226 Y:3114694-3114716 CCAGGCTTCTGGATAAGGGCAGG + Intergenic
1200561537 Y:4709503-4709525 CCTTAATTCTGGTGCAGTGCAGG + Intergenic