ID: 1034966098

View in Genome Browser
Species Human (GRCh38)
Location 7:155392095-155392117
Sequence ATGGCTTTCCTCGGAAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034966092_1034966098 19 Left 1034966092 7:155392053-155392075 CCCTAGCAGCACGAGATCAAATT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1034966098 7:155392095-155392117 ATGGCTTTCCTCGGAAGCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 94
1034966093_1034966098 18 Left 1034966093 7:155392054-155392076 CCTAGCAGCACGAGATCAAATTT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1034966098 7:155392095-155392117 ATGGCTTTCCTCGGAAGCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 94
1034966091_1034966098 26 Left 1034966091 7:155392046-155392068 CCAATAGCCCTAGCAGCACGAGA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1034966098 7:155392095-155392117 ATGGCTTTCCTCGGAAGCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 94
1034966095_1034966098 -6 Left 1034966095 7:155392078-155392100 CCTCAGATATCAACCAAATGGCT 0: 1
1: 0
2: 0
3: 27
4: 161
Right 1034966098 7:155392095-155392117 ATGGCTTTCCTCGGAAGCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034966098 Original CRISPR ATGGCTTTCCTCGGAAGCTC AGG Intronic
900638391 1:3676515-3676537 GTGGCTTTCGTGGGAAGCTATGG + Intronic
901512147 1:9722715-9722737 AGGGCTTTCCTAGGAAGACCCGG + Intronic
901653220 1:10755014-10755036 TTGGCTTTCCTCCGAAGCAGGGG - Intronic
907267863 1:53273799-53273821 ATGCTCTTCCTGGGAAGCTCAGG + Intronic
908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG + Intergenic
915476930 1:156158544-156158566 ACGACTTTCCTCTGTAGCTCTGG + Intronic
916282560 1:163068267-163068289 ATAGCTTTCCTCTGTAACTCTGG + Intergenic
918031548 1:180818138-180818160 ATGGTTTTCTTCAGAAGATCTGG + Intronic
921337551 1:214103497-214103519 AGGGCTTTCCTAGTAAGCCCTGG + Intergenic
1063968771 10:11367134-11367156 ATGGCATTCCTGGGCAGCTCTGG - Intergenic
1064909243 10:20382465-20382487 ACGGCTTTCCTGGGAAGCACTGG + Intergenic
1065403299 10:25331665-25331687 ATGGCTTTCATCGGTATATCTGG + Intronic
1068744901 10:60518903-60518925 ATGGCGTTGCTGGGAAGCACTGG + Intronic
1070484141 10:76913521-76913543 AGGGCATTTCTCAGAAGCTCTGG - Intronic
1073424147 10:103446098-103446120 GTGGCTTTCCTCAGCAGCCCAGG - Exonic
1073438244 10:103535489-103535511 ATGACTGTCCTCGGCAGCCCAGG + Intronic
1074938320 10:118209301-118209323 ATGGCTTTCCAGGGAGGCCCTGG + Intergenic
1077935799 11:6784274-6784296 AGGGCTTTCCTAGGAAGATCAGG - Intergenic
1079075429 11:17382689-17382711 TTGCCTTCCCTCTGAAGCTCAGG + Intergenic
1086013539 11:82136053-82136075 ATGTCTGTCCCTGGAAGCTCAGG - Intergenic
1089076721 11:115744462-115744484 ATGTCTTTCCTGGGCAGCTGTGG - Intergenic
1090984031 11:131750066-131750088 ATGGCTTTCCACCTAAGGTCAGG - Intronic
1091461148 12:644047-644069 ATGGTGTTCCTGGGAAACTCTGG - Intronic
1092678763 12:10953346-10953368 ATGGCGTTCCTCAGAATCTTTGG - Intronic
1099953217 12:89326903-89326925 ATGGCTGTCCTCGGAAGTCCAGG - Intergenic
1101650270 12:106671374-106671396 ATGGCCTTCCTGGGTGGCTCTGG + Intronic
1103362964 12:120364511-120364533 ATGTCTTTCCACGTGAGCTCTGG - Intronic
1103860188 12:124006228-124006250 TTGGCATTCCTCTGATGCTCTGG + Intronic
1103983378 12:124751122-124751144 ACAGCTTTCCTCGCAAGCTCAGG + Intergenic
1109310920 13:60692446-60692468 ATGGCATTCCAAGGAAGCTTGGG - Intergenic
1112455459 13:99557749-99557771 ATGGCTTACTTGGGAAGCTGAGG + Intronic
1113316365 13:109183841-109183863 ATGGCTTTCATCGGCAGCTATGG - Intronic
1114543753 14:23483270-23483292 ATGGCTTTCCTGGGAAGAGAGGG - Intronic
1117376547 14:55123166-55123188 AAGTCTTTCCTGGGAAGCTGGGG - Intergenic
1118714867 14:68552101-68552123 CTGGCTTTGCTGGGAAGCCCAGG + Intronic
1119187297 14:72651875-72651897 TTGCCTTTGCTGGGAAGCTCAGG + Intronic
1121273440 14:92652388-92652410 TTGGCTGTCCTGGGCAGCTCTGG - Exonic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1126929336 15:53630773-53630795 AATGCTTTCCTCGTAAGGTCAGG + Intronic
1129781312 15:78273758-78273780 ATGGCTTTTCTTGAAAACTCAGG - Intronic
1134798455 16:17062874-17062896 ATGGCATTCCAGGGAAGCTCCGG + Intergenic
1135466680 16:22692679-22692701 ATGGCTTTCCTGTGTATCTCTGG + Intergenic
1135989136 16:27206786-27206808 ATGGCCCTCCTGGGAAGGTCAGG - Intronic
1136542726 16:30937335-30937357 ACTGCTTTCCTCGGAGTCTCAGG + Intronic
1138742668 16:59328966-59328988 ATTGCTTTCATCTGAAGCTGCGG + Intergenic
1141278902 16:82613047-82613069 AGGGCTTTCTTCTGAAGCTGTGG - Intergenic
1148985243 17:51615152-51615174 CTGGCTTTTCTGGGAAGCCCGGG + Intergenic
1150686673 17:67326616-67326638 ATGGCTGTCCTCTAAAGGTCAGG - Intergenic
1156312341 18:35936060-35936082 CTGGCTTTCCTCGGCAGGGCAGG - Intergenic
1157686306 18:49645371-49645393 ATGGCTTACCTTGGTAGCCCTGG + Intergenic
1159033066 18:63250985-63251007 ATGGCTTTCCTCCACCGCTCTGG + Intronic
1164575634 19:29403902-29403924 ATGGCTTTTCTGAGAAGCACGGG + Intergenic
1165989683 19:39802989-39803011 ATGTCTTTCCTCCTAAACTCTGG - Intergenic
927509789 2:23637198-23637220 ATTGCTTTCCTCGGAATCAGAGG - Intronic
936508090 2:113124153-113124175 ATGGCTTTCATCGGAGGTCCTGG - Intronic
941799850 2:169646831-169646853 ATGGCTTTTCTGTGATGCTCTGG + Intronic
945177993 2:207062843-207062865 GTGGCTTTCCTCGGGAATTCTGG + Intergenic
946175675 2:217920793-217920815 ATGGCTTTCTTTGGAAGGGCTGG - Intronic
1169287888 20:4324860-4324882 AGGGCTTTCTTTGGAAGCTGAGG + Intergenic
1171311715 20:24150219-24150241 CTGGCTGTCCTCGGAAGCTGGGG + Intergenic
1172698355 20:36837288-36837310 CTGCCTGTCTTCGGAAGCTCTGG - Intronic
1179162242 21:38908199-38908221 ATTGCTCTCCTTGGAAGGTCTGG - Intergenic
1181901114 22:26156513-26156535 AGGGCTTTCCTGGGAAGAGCCGG + Intergenic
1184565018 22:45286584-45286606 TTGGCTTGTCTCAGAAGCTCAGG - Intronic
954166039 3:48758834-48758856 ATGACTTTCCTCAGAAGCCTGGG + Intronic
955508093 3:59652034-59652056 CTGGCTTTCCTGCCAAGCTCAGG - Intergenic
959909550 3:111748349-111748371 ATTTCCTTCCCCGGAAGCTCAGG - Intronic
960655415 3:119998480-119998502 ATGGCTTAGCTAGGAACCTCTGG - Intronic
960915210 3:122688046-122688068 ATGGCTTTCTTAGGCAGCTCAGG + Intronic
962533769 3:136308347-136308369 ATGTCCTTCCTGGGAAGCTGAGG - Intronic
962866142 3:139449375-139449397 ATCACTCTCCTCAGAAGCTCTGG + Intergenic
965392013 3:168116457-168116479 ATGGCTGTTCTCAGAAGTTCTGG - Intergenic
966895226 3:184439856-184439878 ATGGTTTTCCCTGGCAGCTCAGG + Intronic
968456422 4:702871-702893 ATGGCTTTCCAAGGCTGCTCTGG - Intergenic
974841428 4:67303792-67303814 ATGGCTTTCCTCCTAACTTCTGG + Intergenic
975654074 4:76623464-76623486 AGTGCTTTCCTTGGAACCTCTGG - Intronic
980113624 4:128658631-128658653 ATTGCTTTCCTGGCCAGCTCTGG + Intergenic
983346939 4:166538832-166538854 ATGGCTTTCCCCTGAAGATCAGG + Intergenic
985848449 5:2371329-2371351 ATGGCTGCGCTTGGAAGCTCCGG + Intergenic
986055866 5:4136106-4136128 ATGGCTTTCCAAGGACCCTCTGG - Intergenic
986606890 5:9531589-9531611 GAGGCTTTCCTAGGAACCTCAGG - Intronic
987990962 5:25212349-25212371 ATGCCTTCCCTCTGAAGATCTGG - Intergenic
994655263 5:102585011-102585033 ATGGCTGTCCTCGTCAGCTGGGG - Intergenic
999511941 5:152261263-152261285 ATGCCTTTCTTGAGAAGCTCAGG + Intergenic
1001372010 5:171214168-171214190 ATAGTTTGCCTCAGAAGCTCTGG + Intronic
1001605232 5:172954955-172954977 ATGGCTTCCCTGGGAAGTTGCGG + Intergenic
1003555604 6:7137174-7137196 CTGGCTTTCCTGGGAAGGCCTGG + Intronic
1005356769 6:24991850-24991872 TTAGCTTCCCTCGGAAGGTCTGG - Intronic
1006177441 6:32130916-32130938 ATGGCTTACCTGGGAAGCGGAGG + Intergenic
1012134791 6:95542458-95542480 ATGGCTTTTCTGGGTAGCACTGG + Intergenic
1014211214 6:118710169-118710191 GTGGTTTTACACGGAAGCTCAGG - Intergenic
1015326572 6:131930453-131930475 GTGTCTTTCTTTGGAAGCTCGGG + Intergenic
1018816623 6:167337290-167337312 ATGGCTTGCCTGGGCAGCCCTGG + Intronic
1022414729 7:30168172-30168194 CTGGCTTTCCATGGCAGCTCTGG + Intergenic
1027135050 7:75618003-75618025 AAGGCTTCCCCCGGGAGCTCTGG - Intronic
1034604183 7:152295711-152295733 ATGGCTTTCCTCTGAGGCTGGGG - Intronic
1034966098 7:155392095-155392117 ATGGCTTTCCTCGGAAGCTCAGG + Intronic
1035694472 8:1584636-1584658 ATGTCTCTCCTCAGAAGCTCAGG + Intronic
1036077069 8:5513856-5513878 ATGGATGTCCTCTGTAGCTCAGG + Intergenic
1036621396 8:10426425-10426447 ATGGCATTCCACGGACTCTCTGG + Intronic
1040005757 8:42619314-42619336 ATGGCTTTTATCCCAAGCTCTGG + Intergenic
1044875607 8:96662959-96662981 AGGGCTTTGCTCTGTAGCTCAGG - Intronic
1045791666 8:105990906-105990928 ACAGCTTTCCTCTGGAGCTCAGG - Intergenic
1050460838 9:5876022-5876044 ATGGCTTTGCTGGGAAGCTGTGG + Intergenic
1055941687 9:81656239-81656261 ATGGCTCTCCTCGAAAGCATGGG + Intronic
1058939495 9:109799856-109799878 AAGGCTTTCCACTGAAGCTGGGG - Intronic
1059457934 9:114411589-114411611 ATGACTTTCCAGGGAAGCTCAGG + Intronic
1060168922 9:121444418-121444440 AAGGCTTGCCCCTGAAGCTCAGG - Intergenic
1189527766 X:41843240-41843262 AATGCTTTCCTCCGAAGATCAGG - Intronic
1190046950 X:47119800-47119822 AATGCTTTCCTCGTAAGATCTGG + Intergenic