ID: 1034966909

View in Genome Browser
Species Human (GRCh38)
Location 7:155397301-155397323
Sequence CACCCAATAGGGTTTTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034966909_1034966914 5 Left 1034966909 7:155397301-155397323 CCTTTCAAAAACCCTATTGGGTG No data
Right 1034966914 7:155397329-155397351 CAGTGTTTCCCTCCAAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034966909 Original CRISPR CACCCAATAGGGTTTTTGAA AGG (reversed) Intergenic
No off target data available for this crispr