ID: 1034966914

View in Genome Browser
Species Human (GRCh38)
Location 7:155397329-155397351
Sequence CAGTGTTTCCCTCCAAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034966913_1034966914 -7 Left 1034966913 7:155397313-155397335 CCTATTGGGTGGGTAACAGTGTT No data
Right 1034966914 7:155397329-155397351 CAGTGTTTCCCTCCAAGTTGAGG No data
1034966912_1034966914 -6 Left 1034966912 7:155397312-155397334 CCCTATTGGGTGGGTAACAGTGT No data
Right 1034966914 7:155397329-155397351 CAGTGTTTCCCTCCAAGTTGAGG No data
1034966909_1034966914 5 Left 1034966909 7:155397301-155397323 CCTTTCAAAAACCCTATTGGGTG No data
Right 1034966914 7:155397329-155397351 CAGTGTTTCCCTCCAAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034966914 Original CRISPR CAGTGTTTCCCTCCAAGTTG AGG Intergenic
No off target data available for this crispr