ID: 1034967487

View in Genome Browser
Species Human (GRCh38)
Location 7:155400194-155400216
Sequence CTGTTGCCCCTCAGTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034967487_1034967496 9 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967496 7:155400226-155400248 CGTGCTGCAGGTGGAGGGAGTGG No data
1034967487_1034967499 26 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG No data
1034967487_1034967497 10 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967497 7:155400227-155400249 GTGCTGCAGGTGGAGGGAGTGGG No data
1034967487_1034967498 22 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967498 7:155400239-155400261 GAGGGAGTGGGAAATGAGAGCGG No data
1034967487_1034967490 0 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967490 7:155400217-155400239 CCCCACATCCGTGCTGCAGGTGG No data
1034967487_1034967494 4 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967494 7:155400221-155400243 ACATCCGTGCTGCAGGTGGAGGG No data
1034967487_1034967488 -3 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967488 7:155400214-155400236 CAGCCCCACATCCGTGCTGCAGG No data
1034967487_1034967493 3 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967493 7:155400220-155400242 CACATCCGTGCTGCAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034967487 Original CRISPR CTGTTGCCCCTCAGTCACCC AGG (reversed) Intergenic
No off target data available for this crispr