ID: 1034967492

View in Genome Browser
Species Human (GRCh38)
Location 7:155400219-155400241
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034967492_1034967499 1 Left 1034967492 7:155400219-155400241 CCACATCCGTGCTGCAGGTGGAG No data
Right 1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG No data
1034967492_1034967498 -3 Left 1034967492 7:155400219-155400241 CCACATCCGTGCTGCAGGTGGAG No data
Right 1034967498 7:155400239-155400261 GAGGGAGTGGGAAATGAGAGCGG No data
1034967492_1034967500 22 Left 1034967492 7:155400219-155400241 CCACATCCGTGCTGCAGGTGGAG No data
Right 1034967500 7:155400264-155400286 GGCAAGCAGCCTCCTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034967492 Original CRISPR CTCCACCTGCAGCACGGATG TGG (reversed) Intergenic
No off target data available for this crispr