ID: 1034967499

View in Genome Browser
Species Human (GRCh38)
Location 7:155400243-155400265
Sequence GAGTGGGAAATGAGAGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034967492_1034967499 1 Left 1034967492 7:155400219-155400241 CCACATCCGTGCTGCAGGTGGAG No data
Right 1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG No data
1034967495_1034967499 -5 Left 1034967495 7:155400225-155400247 CCGTGCTGCAGGTGGAGGGAGTG No data
Right 1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG No data
1034967491_1034967499 2 Left 1034967491 7:155400218-155400240 CCCACATCCGTGCTGCAGGTGGA No data
Right 1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG No data
1034967487_1034967499 26 Left 1034967487 7:155400194-155400216 CCTGGGTGACTGAGGGGCAACAG No data
Right 1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG No data
1034967489_1034967499 3 Left 1034967489 7:155400217-155400239 CCCCACATCCGTGCTGCAGGTGG No data
Right 1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034967499 Original CRISPR GAGTGGGAAATGAGAGCGGA TGG Intergenic
No off target data available for this crispr