ID: 1034968321

View in Genome Browser
Species Human (GRCh38)
Location 7:155404732-155404754
Sequence CACACCACGGGCCCCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034968315_1034968321 -3 Left 1034968315 7:155404712-155404734 CCGGGCAGCAGCGTGGCCTCCAC No data
Right 1034968321 7:155404732-155404754 CACACCACGGGCCCCCCAGCGGG No data
1034968314_1034968321 -2 Left 1034968314 7:155404711-155404733 CCCGGGCAGCAGCGTGGCCTCCA No data
Right 1034968321 7:155404732-155404754 CACACCACGGGCCCCCCAGCGGG No data
1034968311_1034968321 5 Left 1034968311 7:155404704-155404726 CCCTCAGCCCGGGCAGCAGCGTG No data
Right 1034968321 7:155404732-155404754 CACACCACGGGCCCCCCAGCGGG No data
1034968312_1034968321 4 Left 1034968312 7:155404705-155404727 CCTCAGCCCGGGCAGCAGCGTGG No data
Right 1034968321 7:155404732-155404754 CACACCACGGGCCCCCCAGCGGG No data
1034968308_1034968321 20 Left 1034968308 7:155404689-155404711 CCTGCAGGTTCGGGTCCCTCAGC No data
Right 1034968321 7:155404732-155404754 CACACCACGGGCCCCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034968321 Original CRISPR CACACCACGGGCCCCCCAGC GGG Intergenic
No off target data available for this crispr