ID: 1034969625

View in Genome Browser
Species Human (GRCh38)
Location 7:155410943-155410965
Sequence CTGCCTGTGAAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969625_1034969631 25 Left 1034969625 7:155410943-155410965 CCTTCCTCCATCTTCACAGGCAG No data
Right 1034969631 7:155410991-155411013 TTCCTAGTCACACCTGCCCCTGG No data
1034969625_1034969628 -4 Left 1034969625 7:155410943-155410965 CCTTCCTCCATCTTCACAGGCAG No data
Right 1034969628 7:155410962-155410984 GCAGCAAAGTTGCCTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969625 Original CRISPR CTGCCTGTGAAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr