ID: 1034969722

View in Genome Browser
Species Human (GRCh38)
Location 7:155411353-155411375
Sequence GACCCCCCAGATGACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969722_1034969732 20 Left 1034969722 7:155411353-155411375 CCCTCCAGGTCATCTGGGGGGTC No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969722_1034969729 13 Left 1034969722 7:155411353-155411375 CCCTCCAGGTCATCTGGGGGGTC No data
Right 1034969729 7:155411389-155411411 TTTCCCACAGCCTCCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969722 Original CRISPR GACCCCCCAGATGACCTGGA GGG (reversed) Intergenic