ID: 1034969723

View in Genome Browser
Species Human (GRCh38)
Location 7:155411354-155411376
Sequence AGACCCCCCAGATGACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969723_1034969732 19 Left 1034969723 7:155411354-155411376 CCTCCAGGTCATCTGGGGGGTCT No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969723_1034969729 12 Left 1034969723 7:155411354-155411376 CCTCCAGGTCATCTGGGGGGTCT No data
Right 1034969729 7:155411389-155411411 TTTCCCACAGCCTCCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969723 Original CRISPR AGACCCCCCAGATGACCTGG AGG (reversed) Intergenic