ID: 1034969724 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:155411357-155411379 |
| Sequence | GAGAGACCCCCCAGATGACC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034969724_1034969732 | 16 | Left | 1034969724 | 7:155411357-155411379 | CCAGGTCATCTGGGGGGTCTCTC | No data | ||
| Right | 1034969732 | 7:155411396-155411418 | CAGCCTCCCTCTGAGGAACTCGG | No data | ||||
| 1034969724_1034969729 | 9 | Left | 1034969724 | 7:155411357-155411379 | CCAGGTCATCTGGGGGGTCTCTC | No data | ||
| Right | 1034969729 | 7:155411389-155411411 | TTTCCCACAGCCTCCCTCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034969724 | Original CRISPR | GAGAGACCCCCCAGATGACC TGG (reversed) | Intergenic | ||