ID: 1034969725

View in Genome Browser
Species Human (GRCh38)
Location 7:155411379-155411401
Sequence AGGCTGTGGGAAAGCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969725_1034969732 -6 Left 1034969725 7:155411379-155411401 CCCCTCCTGCTTTCCCACAGCCT No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969725_1034969736 12 Left 1034969725 7:155411379-155411401 CCCCTCCTGCTTTCCCACAGCCT No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969725 Original CRISPR AGGCTGTGGGAAAGCAGGAG GGG (reversed) Intergenic