ID: 1034969727

View in Genome Browser
Species Human (GRCh38)
Location 7:155411381-155411403
Sequence GGAGGCTGTGGGAAAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969727_1034969732 -8 Left 1034969727 7:155411381-155411403 CCTCCTGCTTTCCCACAGCCTCC No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969727_1034969736 10 Left 1034969727 7:155411381-155411403 CCTCCTGCTTTCCCACAGCCTCC No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969727 Original CRISPR GGAGGCTGTGGGAAAGCAGG AGG (reversed) Intergenic