ID: 1034969729

View in Genome Browser
Species Human (GRCh38)
Location 7:155411389-155411411
Sequence TTTCCCACAGCCTCCCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969714_1034969729 29 Left 1034969714 7:155411337-155411359 CCCAGGAAGAGGGGGTCCCTCCA No data
Right 1034969729 7:155411389-155411411 TTTCCCACAGCCTCCCTCTGAGG No data
1034969722_1034969729 13 Left 1034969722 7:155411353-155411375 CCCTCCAGGTCATCTGGGGGGTC No data
Right 1034969729 7:155411389-155411411 TTTCCCACAGCCTCCCTCTGAGG No data
1034969723_1034969729 12 Left 1034969723 7:155411354-155411376 CCTCCAGGTCATCTGGGGGGTCT No data
Right 1034969729 7:155411389-155411411 TTTCCCACAGCCTCCCTCTGAGG No data
1034969715_1034969729 28 Left 1034969715 7:155411338-155411360 CCAGGAAGAGGGGGTCCCTCCAG No data
Right 1034969729 7:155411389-155411411 TTTCCCACAGCCTCCCTCTGAGG No data
1034969724_1034969729 9 Left 1034969724 7:155411357-155411379 CCAGGTCATCTGGGGGGTCTCTC No data
Right 1034969729 7:155411389-155411411 TTTCCCACAGCCTCCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969729 Original CRISPR TTTCCCACAGCCTCCCTCTG AGG Intergenic