ID: 1034969732

View in Genome Browser
Species Human (GRCh38)
Location 7:155411396-155411418
Sequence CAGCCTCCCTCTGAGGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969726_1034969732 -7 Left 1034969726 7:155411380-155411402 CCCTCCTGCTTTCCCACAGCCTC No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969725_1034969732 -6 Left 1034969725 7:155411379-155411401 CCCCTCCTGCTTTCCCACAGCCT No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969722_1034969732 20 Left 1034969722 7:155411353-155411375 CCCTCCAGGTCATCTGGGGGGTC No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969727_1034969732 -8 Left 1034969727 7:155411381-155411403 CCTCCTGCTTTCCCACAGCCTCC No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969723_1034969732 19 Left 1034969723 7:155411354-155411376 CCTCCAGGTCATCTGGGGGGTCT No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data
1034969724_1034969732 16 Left 1034969724 7:155411357-155411379 CCAGGTCATCTGGGGGGTCTCTC No data
Right 1034969732 7:155411396-155411418 CAGCCTCCCTCTGAGGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969732 Original CRISPR CAGCCTCCCTCTGAGGAACT CGG Intergenic