ID: 1034969736

View in Genome Browser
Species Human (GRCh38)
Location 7:155411414-155411436
Sequence CTCGGTGAGCCTTCCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969731_1034969736 -2 Left 1034969731 7:155411393-155411415 CCACAGCCTCCCTCTGAGGAACT No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data
1034969727_1034969736 10 Left 1034969727 7:155411381-155411403 CCTCCTGCTTTCCCACAGCCTCC No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data
1034969728_1034969736 7 Left 1034969728 7:155411384-155411406 CCTGCTTTCCCACAGCCTCCCTC No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data
1034969725_1034969736 12 Left 1034969725 7:155411379-155411401 CCCCTCCTGCTTTCCCACAGCCT No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data
1034969730_1034969736 -1 Left 1034969730 7:155411392-155411414 CCCACAGCCTCCCTCTGAGGAAC No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data
1034969726_1034969736 11 Left 1034969726 7:155411380-155411402 CCCTCCTGCTTTCCCACAGCCTC No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data
1034969733_1034969736 -8 Left 1034969733 7:155411399-155411421 CCTCCCTCTGAGGAACTCGGTGA No data
Right 1034969736 7:155411414-155411436 CTCGGTGAGCCTTCCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969736 Original CRISPR CTCGGTGAGCCTTCCTCAGA AGG Intergenic