ID: 1034969785

View in Genome Browser
Species Human (GRCh38)
Location 7:155411640-155411662
Sequence CTGGAGCCACAGAGCGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969773_1034969785 23 Left 1034969773 7:155411594-155411616 CCCAACTGTCAGCCCCAAAGATG No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969781_1034969785 -7 Left 1034969781 7:155411624-155411646 CCCATCCACCACATTGCTGGAGC No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969774_1034969785 22 Left 1034969774 7:155411595-155411617 CCAACTGTCAGCCCCAAAGATGA No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969772_1034969785 30 Left 1034969772 7:155411587-155411609 CCTAAAACCCAACTGTCAGCCCC No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969776_1034969785 10 Left 1034969776 7:155411607-155411629 CCCAAAGATGACCACCACCCATC No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969777_1034969785 9 Left 1034969777 7:155411608-155411630 CCAAAGATGACCACCACCCATCC No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969775_1034969785 11 Left 1034969775 7:155411606-155411628 CCCCAAAGATGACCACCACCCAT No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969779_1034969785 -4 Left 1034969779 7:155411621-155411643 CCACCCATCCACCACATTGCTGG No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969782_1034969785 -8 Left 1034969782 7:155411625-155411647 CCATCCACCACATTGCTGGAGCC No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data
1034969778_1034969785 -1 Left 1034969778 7:155411618-155411640 CCACCACCCATCCACCACATTGC No data
Right 1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969785 Original CRISPR CTGGAGCCACAGAGCGACCA AGG Intergenic
No off target data available for this crispr