ID: 1034969844

View in Genome Browser
Species Human (GRCh38)
Location 7:155412133-155412155
Sequence CAGGCCCCAGCACTTGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969844_1034969849 22 Left 1034969844 7:155412133-155412155 CCACCAACAAGTGCTGGGGCCTG No data
Right 1034969849 7:155412178-155412200 GATCCTCCTTGCCTGTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969844 Original CRISPR CAGGCCCCAGCACTTGTTGG TGG (reversed) Intergenic
No off target data available for this crispr