ID: 1034969968

View in Genome Browser
Species Human (GRCh38)
Location 7:155412824-155412846
Sequence GGCACAGGAAAGCCCCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034969962_1034969968 23 Left 1034969962 7:155412778-155412800 CCCTGCCAGGGAGGACGTGGGAG No data
Right 1034969968 7:155412824-155412846 GGCACAGGAAAGCCCCCTAGAGG No data
1034969963_1034969968 22 Left 1034969963 7:155412779-155412801 CCTGCCAGGGAGGACGTGGGAGC No data
Right 1034969968 7:155412824-155412846 GGCACAGGAAAGCCCCCTAGAGG No data
1034969967_1034969968 -10 Left 1034969967 7:155412811-155412833 CCTTGTGTCTGCAGGCACAGGAA No data
Right 1034969968 7:155412824-155412846 GGCACAGGAAAGCCCCCTAGAGG No data
1034969964_1034969968 18 Left 1034969964 7:155412783-155412805 CCAGGGAGGACGTGGGAGCGCTG No data
Right 1034969968 7:155412824-155412846 GGCACAGGAAAGCCCCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034969968 Original CRISPR GGCACAGGAAAGCCCCCTAG AGG Intergenic
No off target data available for this crispr