ID: 1034971056

View in Genome Browser
Species Human (GRCh38)
Location 7:155419296-155419318
Sequence CCCATATGGACCCATGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034971045_1034971056 23 Left 1034971045 7:155419250-155419272 CCACAGCTCTGTGTGCAGGGAGA No data
Right 1034971056 7:155419296-155419318 CCCATATGGACCCATGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034971056 Original CRISPR CCCATATGGACCCATGGAGC AGG Intergenic
No off target data available for this crispr