ID: 1034973967

View in Genome Browser
Species Human (GRCh38)
Location 7:155437186-155437208
Sequence TGTCCACTTGGACCCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034973967_1034973970 -4 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973970 7:155437205-155437227 GACACAGTTCCTAATAATGCGGG No data
1034973967_1034973977 24 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973977 7:155437233-155437255 TGAGTCCCAGAATTGGGGCTTGG No data
1034973967_1034973971 -3 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973971 7:155437206-155437228 ACACAGTTCCTAATAATGCGGGG No data
1034973967_1034973975 18 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973975 7:155437227-155437249 GGCAGGTGAGTCCCAGAATTGGG No data
1034973967_1034973974 17 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973974 7:155437226-155437248 GGGCAGGTGAGTCCCAGAATTGG No data
1034973967_1034973969 -5 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973969 7:155437204-155437226 GGACACAGTTCCTAATAATGCGG No data
1034973967_1034973976 19 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973976 7:155437228-155437250 GCAGGTGAGTCCCAGAATTGGGG No data
1034973967_1034973980 30 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973980 7:155437239-155437261 CCAGAATTGGGGCTTGGCCCAGG No data
1034973967_1034973972 1 Left 1034973967 7:155437186-155437208 CCACTTGGGGGTCCAAGTGGACA No data
Right 1034973972 7:155437210-155437232 AGTTCCTAATAATGCGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034973967 Original CRISPR TGTCCACTTGGACCCCCAAG TGG (reversed) Intergenic
No off target data available for this crispr