ID: 1034974316

View in Genome Browser
Species Human (GRCh38)
Location 7:155439063-155439085
Sequence CCAGATAAGGAGACCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034974311_1034974316 -7 Left 1034974311 7:155439047-155439069 CCACAAGACAAGTGAGCCAGATA No data
Right 1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG No data
1034974310_1034974316 -1 Left 1034974310 7:155439041-155439063 CCTGGGCCACAAGACAAGTGAGC No data
Right 1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034974316 Original CRISPR CCAGATAAGGAGACCGTGGA GGG Intergenic
No off target data available for this crispr