ID: 1034974421

View in Genome Browser
Species Human (GRCh38)
Location 7:155439545-155439567
Sequence GAGGGGCGGTGCCCAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034974406_1034974421 26 Left 1034974406 7:155439496-155439518 CCCAGCACCATCTGTCAACTGCA No data
Right 1034974421 7:155439545-155439567 GAGGGGCGGTGCCCAGGACTTGG No data
1034974415_1034974421 -4 Left 1034974415 7:155439526-155439548 CCAGCAGTCAGGGTGTGAGGAGG No data
Right 1034974421 7:155439545-155439567 GAGGGGCGGTGCCCAGGACTTGG No data
1034974412_1034974421 3 Left 1034974412 7:155439519-155439541 CCCGGCACCAGCAGTCAGGGTGT No data
Right 1034974421 7:155439545-155439567 GAGGGGCGGTGCCCAGGACTTGG No data
1034974409_1034974421 19 Left 1034974409 7:155439503-155439525 CCATCTGTCAACTGCACCCGGCA No data
Right 1034974421 7:155439545-155439567 GAGGGGCGGTGCCCAGGACTTGG No data
1034974413_1034974421 2 Left 1034974413 7:155439520-155439542 CCGGCACCAGCAGTCAGGGTGTG No data
Right 1034974421 7:155439545-155439567 GAGGGGCGGTGCCCAGGACTTGG No data
1034974407_1034974421 25 Left 1034974407 7:155439497-155439519 CCAGCACCATCTGTCAACTGCAC No data
Right 1034974421 7:155439545-155439567 GAGGGGCGGTGCCCAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034974421 Original CRISPR GAGGGGCGGTGCCCAGGACT TGG Intergenic