ID: 1034978014

View in Genome Browser
Species Human (GRCh38)
Location 7:155459069-155459091
Sequence GCCGGGACGCGTGGTCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034978014_1034978027 7 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978027 7:155459099-155459121 GGGGAGGCCCGCGGAGCTGGGGG 0: 1
1: 1
2: 4
3: 51
4: 559
1034978014_1034978019 -9 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978019 7:155459083-155459105 CGTCCCGGCTCGCCGCGGGGAGG 0: 1
1: 0
2: 2
3: 9
4: 100
1034978014_1034978029 11 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978029 7:155459103-155459125 AGGCCCGCGGAGCTGGGGGGCGG 0: 1
1: 0
2: 5
3: 50
4: 493
1034978014_1034978028 8 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978028 7:155459100-155459122 GGGAGGCCCGCGGAGCTGGGGGG 0: 1
1: 0
2: 5
3: 64
4: 505
1034978014_1034978024 4 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978024 7:155459096-155459118 CGCGGGGAGGCCCGCGGAGCTGG 0: 1
1: 0
2: 3
3: 31
4: 333
1034978014_1034978032 17 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978032 7:155459109-155459131 GCGGAGCTGGGGGGCGGTGCTGG 0: 1
1: 0
2: 6
3: 83
4: 834
1034978014_1034978034 23 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978034 7:155459115-155459137 CTGGGGGGCGGTGCTGGCGCGGG 0: 1
1: 0
2: 4
3: 36
4: 522
1034978014_1034978022 -2 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978022 7:155459090-155459112 GCTCGCCGCGGGGAGGCCCGCGG 0: 1
1: 0
2: 5
3: 16
4: 162
1034978014_1034978033 22 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978033 7:155459114-155459136 GCTGGGGGGCGGTGCTGGCGCGG 0: 1
1: 0
2: 5
3: 52
4: 642
1034978014_1034978026 6 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978026 7:155459098-155459120 CGGGGAGGCCCGCGGAGCTGGGG 0: 1
1: 1
2: 5
3: 26
4: 319
1034978014_1034978025 5 Left 1034978014 7:155459069-155459091 CCGCGGGGACCACGCGTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1034978025 7:155459097-155459119 GCGGGGAGGCCCGCGGAGCTGGG 0: 1
1: 0
2: 2
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034978014 Original CRISPR GCCGGGACGCGTGGTCCCCG CGG (reversed) Intronic