ID: 1034979583

View in Genome Browser
Species Human (GRCh38)
Location 7:155467376-155467398
Sequence CGCCAGGCCTGCCCGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034979583_1034979588 18 Left 1034979583 7:155467376-155467398 CCCTGGGTCGGGCAGGCCTGGCG No data
Right 1034979588 7:155467417-155467439 AGATTTGTGAGCGATGCTGGTGG No data
1034979583_1034979587 15 Left 1034979583 7:155467376-155467398 CCCTGGGTCGGGCAGGCCTGGCG No data
Right 1034979587 7:155467414-155467436 CACAGATTTGTGAGCGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034979583 Original CRISPR CGCCAGGCCTGCCCGACCCA GGG (reversed) Intergenic
No off target data available for this crispr